Login to display prices
Login to display prices
MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene View larger

MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene

PTXBC008908

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene

Proteogenix catalog: PTXBC008908
Ncbi symbol: MID1IP1
Product name: MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene
Size: 2ug
Accessions: BC008908
Gene id: 58526
Gene description: MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish))
Synonyms: G12-like; MIG12; S14R; STRAIT11499; THRSPL; mid1-interacting protein 1; MID1 interacting G12-like protein; MID1 interacting protein 1 (gastrulation specific G12-like); gastrulation specific G12 homolog; spot 14-R; spot 14-related protein; MID1 interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgcaaatctgcgacacctacaaccagaagcactcgctctttaacgccatgaatcgcttcattggcgccgtgaacaacatggaccagacggtgatggtgcccagcttgctgcgcgacgtgcccctggctgaccccgggttagacaacgatgttggcgtggaggtaggcggcagtggcggctgcctggaggagcgcacgcccccagtccccgactcgggaagcgccaatggcagctttttcgcgccctctcgggacatgtacagccactacgtgcttctcaagtccatccgcaacgacatcgagtggggggtcctgcaccagccgcctccaccggctgggagcgaggagggcagtgcctggaagtccaaggacatcctggtggacctgggccacttggagggtgcggacgccggcgaagaagacctggaacagcagttccactaccacctgcgcgggctgcacactgtgctctcgaaactcacgcgcaaagccaacatcctcactaacagatacaagcaggagatcggcttcggcaattggggccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: