Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene
PTXBC008908
New product
Data sheet of MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008908 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MID1IP1 |
| Origin species: | Human |
| Product name: | MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene |
| Size: | 2ug |
| Accessions: | BC008908 |
| Gene id: | 58526 |
| Gene description: | MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) |
| Synonyms: | G12-like; MIG12; S14R; STRAIT11499; THRSPL; mid1-interacting protein 1; MID1 interacting G12-like protein; MID1 interacting protein 1 (gastrulation specific G12-like); gastrulation specific G12 homolog; spot 14-R; spot 14-related protein; MID1 interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgcaaatctgcgacacctacaaccagaagcactcgctctttaacgccatgaatcgcttcattggcgccgtgaacaacatggaccagacggtgatggtgcccagcttgctgcgcgacgtgcccctggctgaccccgggttagacaacgatgttggcgtggaggtaggcggcagtggcggctgcctggaggagcgcacgcccccagtccccgactcgggaagcgccaatggcagctttttcgcgccctctcgggacatgtacagccactacgtgcttctcaagtccatccgcaacgacatcgagtggggggtcctgcaccagccgcctccaccggctgggagcgaggagggcagtgcctggaagtccaaggacatcctggtggacctgggccacttggagggtgcggacgccggcgaagaagacctggaacagcagttccactaccacctgcgcgggctgcacactgtgctctcgaaactcacgcgcaaagccaacatcctcactaacagatacaagcaggagatcggcttcggcaattggggccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translation initiation factor eIF-2B subunit alpha/beta/delta-like protein - solute carrier family 10 (sodium/bile acid cotransporter family), member 3 - family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 - TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa |