MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene View larger

MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008908
Product type: DNA & cDNA
Ncbi symbol: MID1IP1
Origin species: Human
Product name: MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene
Size: 2ug
Accessions: BC008908
Gene id: 58526
Gene description: MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish))
Synonyms: G12-like; MIG12; S14R; STRAIT11499; THRSPL; mid1-interacting protein 1; MID1 interacting G12-like protein; MID1 interacting protein 1 (gastrulation specific G12-like); gastrulation specific G12 homolog; spot 14-R; spot 14-related protein; MID1 interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgcaaatctgcgacacctacaaccagaagcactcgctctttaacgccatgaatcgcttcattggcgccgtgaacaacatggaccagacggtgatggtgcccagcttgctgcgcgacgtgcccctggctgaccccgggttagacaacgatgttggcgtggaggtaggcggcagtggcggctgcctggaggagcgcacgcccccagtccccgactcgggaagcgccaatggcagctttttcgcgccctctcgggacatgtacagccactacgtgcttctcaagtccatccgcaacgacatcgagtggggggtcctgcaccagccgcctccaccggctgggagcgaggagggcagtgcctggaagtccaaggacatcctggtggacctgggccacttggagggtgcggacgccggcgaagaagacctggaacagcagttccactaccacctgcgcgggctgcacactgtgctctcgaaactcacgcgcaaagccaacatcctcactaacagatacaagcaggagatcggcttcggcaattggggccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translation initiation factor eIF-2B subunit alpha/beta/delta-like protein
- solute carrier family 10 (sodium/bile acid cotransporter family), member 3
- family with sequence similarity 19 (chemokine (C-C motif)-like), member A4
- TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa

Buy MID1IP1-MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) Gene now

Add to cart