Login to display prices
Login to display prices
DCT-dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) Gene View larger

DCT-dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) Gene

PTXBC028311

New product

Data sheet of DCT-dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCT-dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC028311
Ncbi symbol: DCT
Product name: DCT-dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) Gene
Size: 2ug
Accessions: BC028311
Gene id: 1638
Gene description: dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)
Synonyms: TRP-2; TYRP2; L-dopachrome tautomerase; L-dopachrome Delta-isomerase; L-dopachrome isomerase; TRP2; dopachrome delta-isomerase; dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2); tyrosinase related protein-2; tyrosine-related protein 2; dopachrome tautomerase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccccctttggtgggggtttctgctcagttgcttgggctgcaaaatcctgccaggagcccagggtcagttcccccgagtctgcatgacggtggacagcctagtgaacaaggagtgctgcccacgcctgggtgcagagtcggccaatgtctgtggctctcagcaaggccgggggcagtgcacagaggtgcgagccgacacaaggccctggagtggtccctacatcctacgaaaccaggatgaccgtgagctgtggccaagaaaattcttccaccggacctgcaagtgcacaggaaactttgccggctataattgtggagactgcaagtttggctggaccggtcccaactgcgagcggaagaaaccaccagtgattcggcagaacatccattccttgagtcctcaggaaagagagcagttcttgggcgccttagatctcgcgaagaagagagtacaccccgactacgtgatcaccacacaacactggctgggcctgcttgggcccaatggaacccagccgcagtttgccaactgcagtgtttatgatttttttgtgtggctccattattattctgttagagatacattattaggaccaggacgcccctacagggccatagatttctcacatcaaggacctgcatttgttacctggcaccggtaccatttgttgtgtctggaaagagatctccagcgactcattggcaatgagtcttttgctttgccctactggaactttgccactgggaggaacgagtgtgatgtgtgtacagaccagctgtttggggcagcgagaccagacgatccgactctgattagtcggaactcaagattctccagctgggaaactgtctgtgatagcttggatgactacaaccacctggtcaccttgtgcaatggaacctatgaaggtttgctgagaagaaatcaaatgggaagaaacagcatgaaattgccaaccttaaaagacatacgagattgcctgtctctccagaagtttgacaatcctcccttcttccagaactctaccttcagtttcaggaatgctttggaagggtttgataaagcagatgggactctggattctcaagtgatgagccttcataatttggttcattccttcctgaacgggacaaacgctttgccacattcagccgccaatgatcccatttttgtggttcttcattcctttactgatgccatctttgatgagtggatgaaaagatttaatcctcctgcagatgcctggcctcaggagctggcccctattggtcacaatcggatgtacaacatggttcctttcttccctccagtgactaatgaagaactctttttaacctcagaccaacttggctacagctatgccatcgatctgccagtttcagttgaagaaactccaggttggcccacaactctcttagtagtcatgggaacactggtggctttggttggtctttttgtgctgttggcttttcttcaatatagaagacttcgaaaaggatatacacccctaatggagacacatttaagcagcaagagatacacagaagaagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: