Cart 27 Product Products 3 523,03 € (empty)
-
1 x HIST1H2AJ-...113,40 € -
1 x CYTH2-cyto...121,50 € -
1 x ITGB3BP-in...113,40 € -
1 x ADH4-alcoh...121,50 € -
1 x GLIPR1-GLI...121,50 € -
1 x NUSAP1-nuc...121,50 € -
-
1 x SLC2A3-sol...121,50 € -
1 x PBX2-pre-B...121,50 € -
1 x FMO2-flavi...121,50 € -
1 x TMEM9B-TME...113,40 € -
-
1 x SPIN2B-spi...113,40 € -
1 x ZNRD1-zinc...113,40 € -
1 x PCGF2-poly...121,50 € -
1 x CRB3-crumb...113,40 € -
-
1 x GGCT-gamma...113,40 € -
1 x NUDCD3-Nud...121,50 € -
1 x SPG7-spast...121,50 € -
-
-
1 x NUP43-nucl...121,50 € -
1 x ZNF688-zin...121,50 € -
-
1 x WWP2-WW...121,50 € -
No products
To be determined Shipping
3 523,03 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 27 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 523,03 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 523,03 €
View larger 
ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
PTXBC031603
New product
Data sheet of ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALS2CR12 |
| Origin species: | Human |
| Product name: | ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene |
| Size: | 2ug |
| Accessions: | BC031603 |
| Gene id: | 130540 |
| Gene description: | amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 |
| Synonyms: | amyotrophic lateral sclerosis 2 chromosomal region candidate gene 12 protein; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12; amyotrophic lateral sclerosis 2 chromosome region candidate 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtaccccaaccctctcatctactgcacctgctgggacccctggaacttgggaccacggaagctaatcaagacccctcaactaccacgcaagaactccacagggagttccaagctaactcctcttctaccagctccaaaaaatcacaattacctccaaccaacaaaacctgttgtttccccaaaaatgaaaatccattcagcaaggcaagaagagactaataaatcattttatgaagtgatcaacgtgtcacctggctatcaacttgttcggaatcgggaacagatttctgtcaccttaggggatgagatgtttgataggaaaaagcggtgggaatcggagatcccggacaaaggcagattttccaggaccaacatcatttctgacctagaagagcaaatctcagagctgacagcaataattgaacaaatgaacagagaccaccagtctgcccagaaattgctctccagtgaaatggatctccgctgtgctgagatgaaacagaactttgaaaacaagaacagggagctcaaagaggcccatgaagcagaactcagtgagttggagaacaactacaaagcagccttgaaggcagagaagttggctgcccaagagaagctagaggagatgggaaaagaatacaagtatttgaagaatatgtttcgtacgtatcaggacagtatttatgatgaaatggaagagaagtggtcaaaacagaaggcgaaatggaagaaggatgagaagttcgagcgagaaaatatcctgctacagcaaaaaaaaaagatgaccaaaaaattcgaaatggagtcaggagaagaagataagaaaataaatgaatcctgcagtgctgtctttgagaacttcattcaagagaaggaggagctcttgaaacaacatcaaagtgacaccttgcaattagaagagctgagaaaaaccaaagaggtcatgcaggaagaattgcatgcacaagcccttatcctagagtcactgaacacaaacctctactatacccagttggaactccagaaagagaaagctatagtgggaaatctggagaaaatgcttcaaaccaagtttgctgaaactgaagaaaagtataagcacaccatacagatcctgacggaagagaacattcatctgaagcaaaagataatttctaagaatgaagaaatttgtgaaggatgttctgggagattggcctctattactgtttctaaggatgattctgacactgtgcaagatggtagcaagaaaggacaagaatcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) - solute carrier family 2 (facilitated glucose/fructose transporter), member 5 - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 |