HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene View larger

HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004929
Product type: DNA & cDNA
Ncbi symbol: HSD3B7
Origin species: Human
Product name: HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene
Size: 2ug
Accessions: BC004929
Gene id: 80270
Gene description: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Synonyms: CBAS1; PFIC4; SDR11E3; 3 beta-hydroxysteroid dehydrogenase type 7; 3 beta-hydroxy-delta 5-C27-steroid oxidoreductase; 3 beta-hydroxysteroid dehydrogenase type VII; 3-beta-HSD VII; 3-beta-hydroxy-Delta(5)-C27 steroid oxidoreductase; C(27)-3BETA-HSD; c(27) 3-beta-HSD; cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase; short chain dehydrogenase/reductase family 11E, member 3; hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgactctgcacaggcccagaagctggtgtacctggtcacagggggctgtggcttcctgggagagcacgtggtgcgaatgctgctgcagcgggagccccggctcggggagctgcgggtctttgaccaacacctgggtccctggctggaggagctgaagacagggcctgtgagggtgactgccatccagggggacgtgacccaggcccatgaggtggcagcagctgtggccggagcccatgtggtcatccacacggctgggctggtagacgtgtttggcagggccagtcccaagaccatccatgaggtcaacgtgcagggtacccggaacgtgatcgaggcttgtgtgcagaccggaacacggttcctggtctacaccagcagcatggaagttgtggggcctaacaccaaaggtcaccccttctacaggggcaacgaagacaccccatacgaagcagtgcacaggcacccctatccttgcagcaaggccctggccgagtggctggtcctggaggccaacgggaggaaggtccgtggggggctgcccctggtgacgtgtgcccttcgtcccacgggcatctacggtgaaggccaccagatcatgagggacttctaccgccagggcctgcgcctgggaggttggctcttccgggccatcccggcctctgtggagcatggccgggtctatgtgggcaatgttgcctggatgcacgtgctggcagcccgggagctggagcagcgggcaaccctgatgggcggccaggtatacttctgctacgatggatcaccctacaggagctatgaggatttcaacatggagttcctgggcccctgcggactgcggctggtgggcgcccgcccattgctgccctactggctgctggtgttcctggctgccctcaatgccctgctgcagtggctgctgcggccactggtgctctacgcacccctgctgaacccctacacgctggccgtggccaacaccaccttcaccgtcagcaccgacaaggctcagcgccatttcggctatgagcccctgttctcgtgggaggatagccggacccgtaccattctctgggtacaggccgctacgggttcagcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
- amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12
- dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)
- solute carrier family 2 (facilitated glucose/fructose transporter), member 5

Buy HSD3B7-hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene now

Add to cart