CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene View larger

CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028078
Product type: DNA & cDNA
Ncbi symbol: CX3CR1
Origin species: Human
Product name: CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene
Size: 2ug
Accessions: BC028078
Gene id: 1524
Gene description: chemokine (C-X3-C motif) receptor 1
Synonyms: CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; V28; CX3C chemokine receptor 1; C-X3-C CKR-1; CMK-BRL-1; CMK-BRL1; G-protein coupled receptor 13; beta chemokine receptor-like 1; chemokine (C-C) receptor-like 1; chemokine (C-X3-C motif) receptor 1; chemokine (C-X3-C) receptor 1; fractalkine receptor; C-X3-C motif chemokine receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcagttccctgaatcagtgacagaaaactttgagtacgatgatttggctgaggcctgttatattggggacatcgtggtctttgggactgtgttcctgtccatattctactccgtcatctttgccattggcctggtgggaaatttgttggtagtgtttgccctcaccaacagcaagaagcccaagagtgtcaccgacatttacctcctgaacctggccttgtctgatctgctgtttgtagccactttgcccttctggactcactatttgataaatgaaaagggcctccacaatgccatgtgcaaattcactaccgccttcttcttcatcggcttttttggaagcatattcttcatcaccgtcatcagcattgataggtacctggccatcgtcctggccgccaactccatgaacaaccggaccgtgcagcatggcgtcaccatcagcctaggcgtctgggcagcagccattttggtggcagcaccccagttcatgttcacaaagcagaaagaaaatgaatgccttggtgactaccccgaggtcctccaggaaatctggcccgtgctccgcaatgtggaaacaaattttcttggcttcctactccccctgctcattatgagttattgctacttcagaatcatccagacgctgttttcctgcaagaaccacaagaaagccaaagccattaaactgatccttctggtggtcatcgtgtttttcctcttctggacaccctacaacgttatgattttcctggagacgcttaagctctatgacttctttcccagttgtgacatgaggaaggatctgaggctggccctcagtgtgactgagacggttgcatttagccattgttgcctgaatcctctcatctatgcatttgctggggagaagttcagaagatacctttaccacctgtatgggaaatgcctggctgtcctgtgtgggcgctcagtccacgttgatttctcctcatctgaatcacaaaggagcaggcatggaagtgttctgagcagcaattttacttaccacacgagtgatggagatgcattgctccttctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxisomal D3,D2-enoyl-CoA isomerase
- peroxisomal D3,D2-enoyl-CoA isomerase
- mitogen-activated protein kinase 11
- zinc finger, DHHC-type containing 9

Buy CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene now

Add to cart