Login to display prices
Login to display prices
CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene View larger

CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene

PTXBC028078

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene

Proteogenix catalog: PTXBC028078
Ncbi symbol: CX3CR1
Product name: CX3CR1-chemokine (C-X3-C motif) receptor 1 Gene
Size: 2ug
Accessions: BC028078
Gene id: 1524
Gene description: chemokine (C-X3-C motif) receptor 1
Synonyms: CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; V28; CX3C chemokine receptor 1; C-X3-C CKR-1; CMK-BRL-1; CMK-BRL1; G-protein coupled receptor 13; beta chemokine receptor-like 1; chemokine (C-C) receptor-like 1; chemokine (C-X3-C motif) receptor 1; chemokine (C-X3-C) receptor 1; fractalkine receptor; C-X3-C motif chemokine receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcagttccctgaatcagtgacagaaaactttgagtacgatgatttggctgaggcctgttatattggggacatcgtggtctttgggactgtgttcctgtccatattctactccgtcatctttgccattggcctggtgggaaatttgttggtagtgtttgccctcaccaacagcaagaagcccaagagtgtcaccgacatttacctcctgaacctggccttgtctgatctgctgtttgtagccactttgcccttctggactcactatttgataaatgaaaagggcctccacaatgccatgtgcaaattcactaccgccttcttcttcatcggcttttttggaagcatattcttcatcaccgtcatcagcattgataggtacctggccatcgtcctggccgccaactccatgaacaaccggaccgtgcagcatggcgtcaccatcagcctaggcgtctgggcagcagccattttggtggcagcaccccagttcatgttcacaaagcagaaagaaaatgaatgccttggtgactaccccgaggtcctccaggaaatctggcccgtgctccgcaatgtggaaacaaattttcttggcttcctactccccctgctcattatgagttattgctacttcagaatcatccagacgctgttttcctgcaagaaccacaagaaagccaaagccattaaactgatccttctggtggtcatcgtgtttttcctcttctggacaccctacaacgttatgattttcctggagacgcttaagctctatgacttctttcccagttgtgacatgaggaaggatctgaggctggccctcagtgtgactgagacggttgcatttagccattgttgcctgaatcctctcatctatgcatttgctggggagaagttcagaagatacctttaccacctgtatgggaaatgcctggctgtcctgtgtgggcgctcagtccacgttgatttctcctcatctgaatcacaaaggagcaggcatggaagtgttctgagcagcaattttacttaccacacgagtgatggagatgcattgctccttctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: