C3orf37-chromosome 3 open reading frame 37 Gene View larger

C3orf37-chromosome 3 open reading frame 37 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf37-chromosome 3 open reading frame 37 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf37-chromosome 3 open reading frame 37 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009993
Product type: DNA & cDNA
Ncbi symbol: C3orf37
Origin species: Human
Product name: C3orf37-chromosome 3 open reading frame 37 Gene
Size: 2ug
Accessions: BC009993
Gene id: 56941
Gene description: chromosome 3 open reading frame 37
Synonyms: UPF0361 protein C3orf37; C3orf37; DC12; SRAPD1; embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein; ES cell-specific 5hmC-binding protein; SRAP domain-containing protein 1; 5-hydroxymethylcytosine (hmC) binding, ES cell-specific
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgggcgaacatcctgtcacttacctagagatgttctcacgagagcttgcgcctaccaggatcggcggggccagcagcggctcccggagtggagggaccctgataagtactgcccctcttacaacaagagtcctcaatccaacagcccagtgcttctgtctcgactgcactttgataaggatgcagactcatctgagcgtatcattgctcccatgcgctggggcttggtcccttcttggttcaaagaaagtgatccttccaagctgcagttcaatactaccaactgtcgtagtgataccgtaatggagaaacggtcatttaaggtgcctctgggaaagggaagacgctgtgtcgttttagcagatggattctatgagtggcagcgatgtcagggaacaaaccagaggcagccatacttcatctattttcctcaaatcaagacagagaagtcaggtagcattggtgctgcagatagtcctgagaactgggagaaagtctgggacaactggaggctgctgacaatggccgggatctttgactgctgggagcccccagagggaggagatgtcctgtattcctataccatcatcacagtggattcctgcaaaggcttgagtgacatccaccacaggatgcctgccatattagatggagaggaggcagtttctaaatggcttgactttggtgaagtctcaactcaggaagctctgaaattaatccacccaacagagaacatcaccttccatgcagtctcttctgtggtgaacaactcgcgaaacaacactcctgagtgtctggctcctgtcgacttggtggtcaaaaaggagctcagggcaagtggcagtagccagaggatgttgcagtggttggccacaaagtcacccaaaaaggaagactcaaaaacacctcaaaaggaagagtcagatgttccccagtggtccagtcagttcctgcagaagagtccactccccaccaagagaggcactgcaggactcctagagcaatggctgaagcgggagaaggaggaggaacctgtggccaagcgtccttacagccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X3-C motif) receptor 1
- peroxisomal D3,D2-enoyl-CoA isomerase
- peroxisomal D3,D2-enoyl-CoA isomerase
- mitogen-activated protein kinase 11

Buy C3orf37-chromosome 3 open reading frame 37 Gene now

Add to cart