CXCR4-chemokine (C-X-C motif) receptor 4 Gene View larger

CXCR4-chemokine (C-X-C motif) receptor 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCR4-chemokine (C-X-C motif) receptor 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXCR4-chemokine (C-X-C motif) receptor 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020968
Product type: DNA & cDNA
Ncbi symbol: CXCR4
Origin species: Human
Product name: CXCR4-chemokine (C-X-C motif) receptor 4 Gene
Size: 2ug
Accessions: BC020968
Gene id: 7852
Gene description: chemokine (C-X-C motif) receptor 4
Synonyms: CD184; D2S201E; FB22; HM89; HSY3RR; LAP-3; LAP3; LCR1; LESTR; NPY3R; NPYR; NPYRL; NPYY3R; WHIM; WHIMS; C-X-C chemokine receptor type 4; CD184 antigen; LPS-associated protein 3; SDF-1 receptor; chemokine (C-X-C motif) receptor 4; chemokine receptor; fusin; leukocyte-derived seven transmembrane domain receptor; lipopolysaccharide-associated protein 3; neuropeptide Y receptor Y3; neuropeptide Y3 receptor; seven transmembrane helix receptor; seven-transmembrane-segment receptor, spleen; stromal cell-derived factor 1 receptor; C-X-C motif chemokine receptor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattggtcatcctggtcatgggttaccagaagaaactgagaagcatgacggacaagtacaggctgcacctgtcagtggccgacctcctctttgtcatcacgcttcccttctgggcagttgatgccgtggcaaactggtactttgggaacttcctatgcaaggcagtccatgtcatctacacagtcaacctctacagcagtgtcctcatcctggccttcatcagtctggaccgctacctggccatcgtccacgccaccaacagtcagaggccaaggaagctgttggctgaaaaggtggtctatgttggcgtctggatccctgccctcctgctgactattcccgacttcatctttgccaacgtcagtgaggcagatgacagatatatctgtgaccgcttctaccccaatgacttgtgggtggttgtgttccagtttcagcacatcatggttggccttatcctgcctggtattgtcatcctgtcctgctattgcattatcatctccaagctgtcacactccaagggccaccagaagcgcaaggccctcaagaccacagtcatcctcatcctggctttcttcgcctgttggctgccttactacattgggatcagcatcgactccttcatcctcctggaaatcatcaagcaagggtgtgagtttgagaacactgtgcacaagtggatttccatcaccgaggccctagctttcttccactgttgtctgaaccccatcctctatgctttccttggagccaaatttaaaacctctgcccagcacgcactcacctctgtgagcagagggtccagcctcaagatcctctccaaaggaaagcgaggtggacattcatctgtttccactgagtctgagtcttcaagttttcactccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 15
- left-right determination factor 2
- TAR (HIV-1) RNA binding protein 2
- chemokine (C-X-C motif) receptor 3

Buy CXCR4-chemokine (C-X-C motif) receptor 4 Gene now

Add to cart