Login to display prices
Login to display prices
TXNDC15-thioredoxin domain containing 15 Gene View larger

TXNDC15-thioredoxin domain containing 15 Gene

PTXBC001615

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC15-thioredoxin domain containing 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC15-thioredoxin domain containing 15 Gene

Proteogenix catalog: PTXBC001615
Ncbi symbol: TXNDC15
Product name: TXNDC15-thioredoxin domain containing 15 Gene
Size: 2ug
Accessions: BC001615
Gene id: 79770
Gene description: thioredoxin domain containing 15
Synonyms: C5orf14; UNQ335; thioredoxin domain-containing protein 15; 2310047H23Rik; disulfide isomerase; thioredoxin domain containing 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcccggctgccggtcgacgaccgccccgcgtcatgcggctcctcggctggtggcaagtattgctgtgggtgctgggacttcccgtccgcggcgtggaggttgcagaggaaagtggtcgcttatggtcagaggagcagcctgctcaccctctccaggttggggctgtgtacctgggtgaggaggagctcctgcatgacccgatgggccaggacagggcagcagaagaggccaatgcggtgctggggctggacacccaaggcgatcacatggtgatgctgtctgtgattcctggggaagctgaggacaaagtgagttcagagcctagcggcgtcacctgtggtgctggaggagcggaggactcaaggtgcaacgtccgagagagccttttctctctggatggcgctggagcacacttccctgacagagaagaggagtattacacagagccagaagtggcggaatctgacgcagccccgacagaggactccaataacactgaaagtctgaaatccccaaaggtgaactgtgaggagagaaacattacaggattagaaaatttcactctgaaaattttaaatatgtcacaggaccttatggattttctgaacccaaacggtagtgactgtactctagtcctgttttacaccccgtggtgccgcttttctgccagtttggcccctcactttaactctctgccccgggcatttccagctcttcactttttggcactggatgcatctcagcacagcagcctttctaccaggtttggcaccgtagctgttcctaatattttattatttcaaggagctaaaccaatggccagatttaatcatacagatcgaacactggaaacactgaaaatcttcatttttaatcagacaggtatagaagccaagaagaatgtggtggtaactcaagccgaccaaataggccctcttcccagcactttgataaaaagtgtggactggttgcttgtattttccttattctttttaattagttttattatgtatgctaccattcgaactgagagtattcggtggctaattccaggacaagagcaggaacatgtggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: