Login to display prices
Login to display prices
TARBP2-TAR (HIV-1) RNA binding protein 2 Gene View larger

TARBP2-TAR (HIV-1) RNA binding protein 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TARBP2-TAR (HIV-1) RNA binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TARBP2-TAR (HIV-1) RNA binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005860
Product type: DNA & cDNA
Ncbi symbol: TARBP2
Origin species: Human
Product name: TARBP2-TAR (HIV-1) RNA binding protein 2 Gene
Size: 2ug
Accessions: BC005860
Gene id: 6895
Gene description: TAR (HIV-1) RNA binding protein 2
Synonyms: TARBP2, RISC loading complex RNA binding subunit; RISC-loading complex subunit TARBP2; LOQS; TRBP; TRBP1; TRBP2; TAR (HIV) RNA-binding protein 2; TAR (HIV) RNA-binding protein TRBP1; TAR (HIV-1) RNA binding protein 2; TAR RNA binding protein 2; trans-activation responsive RNA-binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaagaggagcaaggctccggcactaccacgggctgcgggctgcctagtatagagcaaatgctggccgccaacccaggcaagaccccgatcagccttctgcaggagtatgggaccagaatagggaagacgcctgtgtacgaccttctcaaagccgagggccaagcccaccagcctaatttcaccttccgggtcaccgttggcgacaccagctgcactggtcagggccccagcaagaaggcagccaagcacaaggcagctgaggtggccctcaaacacctcaaaggggggagcatgctggagccggccctggaggacagcagttctttttctcccctagactcttcactgcctgaggacattccggtttttactgctgcagcagctgctaccccagttccatctgtagtcctaaccaggagcccccccatggaactgcagccccctgtctcccctcagcagtctgagtgcaaccccgttggtgctctgcaggagctggtggtgcagaaaggctggcggttgccggagtacacagtgacccaggagtctgggccagcccaccgcaaagaattcaccatgacctgtcgagtggagcgtttcattgagattgggagtggcacttccaaaaaattggcaaagcggaatgcggcggccaaaatgctgcttcgagtgcacacggtgcctctggatgcccgggatggcaatgaggtggagcctgatgatgaccacttctccattggtgtgggctcccgcctggatggtcttcgaaaccggggcccaggttgcacctgggattctctacgaaattcagtaggagagaagatcctgtccctccgcagttgctccctgggctccctgggtgccctgggccctgcctgctgccgtgtcctcagtgagctctctgaggagcaggcctttcacgtcagctacctggatattgaggagctgagcctgagtggactctgccagtgcctggtggaactgtccacccagccggccactgtgtgtcatggctctgcaaccaccagggaggcagcccgtggtgaggctgcccgccgtgccctgcagtacctcaagatcatggcaggcagcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) receptor 3
- interleukin 13 receptor, alpha 2
- transforming growth factor, beta 1
- RNA binding motif protein, X-linked