Login to display prices
Login to display prices
LEFTY2-left-right determination factor 2 Gene View larger

LEFTY2-left-right determination factor 2 Gene

PTXBC035718

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LEFTY2-left-right determination factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LEFTY2-left-right determination factor 2 Gene

Proteogenix catalog: PTXBC035718
Ncbi symbol: LEFTY2
Product name: LEFTY2-left-right determination factor 2 Gene
Size: 2ug
Accessions: BC035718
Gene id: 7044
Gene description: left-right determination factor 2
Synonyms: EBAF; LEFTA; LEFTYA; TGFB4; left-right determination factor 2; TGF-beta-4; endometrial bleeding-associated factor; left-right determination factor A; protein lefty-2; protein lefty-A; transforming growth factor beta-4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcccctgtggctctgctgggcactctgggtgctgcccctggctggccccggggcggccctgaccgaggagcagctcctgggcagcctgctgcggcagctgcagctcagcgaggtgcccgtactggacagggccgacatggagaagctggtcatccccgcccacgtgagggcccagtatgtagtcctgctgcggcgcagccacggggaccgctcccgcggaaagaggttcagccagagcttccgagaggtggccggcaggttcctggcgtcggaggccagcacacacctgctggtgttcggcatggagcagcggctgccgcccaacagcgagctggtgcaggccgtgctgcggctcttccaggagccggtccccaaggccgcgctgcacaggcacgggcggctgtccccgcgcagcgcccaggcccgggtgaccgtcgagtggctgcgcgtccgcgacgacggctccaaccgcacctccctcatcgactccaggctggtgtccgtccacgagagcggctggaaggccttcgacgtgaccgaggccgtgaacttctggcagcagctgagccggccccggcagccgctgctgctacaggtgtcggtgcagagggagcatctgggcccgctggcgtccggcgcccacaagctggtccgctttgcctcgcagggggcgccagccgggcttggggagccccagctggagctgcacaccctggacctcagggactatggagctcagggcgactgtgaccctgaagcaccaatgaccgagggcacccgctgctgccgccaggagatgtacattgacctgcaggggatgaagtgggccaagaactgggtgctggagcccccgggcttcctggcttacgagtgtgtgggcacctgccagcagcccccggaggccctggccttcaattggccatttctggggccgcgacagtgtatcgcctcggagactgcctcgctgcccatgatcgtcagcatcaaggagggaggcaggaccaggccccaggtggtcagcctgcccaacatgagggtgcagaagtgcagctgtgcctcggatggggcgctcgtgccaaggaggctccagccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: