MRPL39-mitochondrial ribosomal protein L39 Gene View larger

MRPL39-mitochondrial ribosomal protein L39 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL39-mitochondrial ribosomal protein L39 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL39-mitochondrial ribosomal protein L39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004896
Product type: DNA & cDNA
Ncbi symbol: MRPL39
Origin species: Human
Product name: MRPL39-mitochondrial ribosomal protein L39 Gene
Size: 2ug
Accessions: BC004896
Gene id: 54148
Gene description: mitochondrial ribosomal protein L39
Synonyms: C21orf92; L39mt; MRP-L5; MRPL5; MSTP003; PRED22; PRED66; RPML5; 39S ribosomal protein L39, mitochondrial; 39S ribosomal protein L5, mitochondrial; L5mt; MRP-L39; mitochondrial ribosomal protein L39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttcccgggcgctgcggctctggctggtcgcacccggtggcgggatcaaatggagatttatagcaacatcgccagcttctcagctgtcaccgacagaattgacagaaatgcggaatgatctctttaataaagagaaagccaggcagttatcattaactccccgaactgagaagatagaagttaagcatgttgggaaaactgaccccggtactgtcttcgtgatgaataaaaacatttcaactccctacagttgtgccatgcatttaagcgagtggtattgcaggaagtccattctggctctggtggatggacagccttgggacatgtataagcctttaacaaagtcctgtgaaattaaatttcttactttcaaagattgtgatccaggagaagtgaataaggcatattggcgttcctgtgctatgatgatgggctgtgtgatagagagggcattcaaagatgaatatatggtcaatttggtcagagctccagaagttcctgtaatttctggtgccttctgttatgacgtagttttggatagcaaacttgatgagtggatgccaacaaaagagaacttacgttccttcacaaaggatgctcatgctttaatttataaagatcttccatttgaaactctggaagttgaagcaaaagtggcattggaaatatttcaacacagcaagtacaaagtagatttcatagaagagaaggcatctcagaaccctgagagaatagtcaagctacacagaataggtgacttcattgatgtgagtgagggccctcttattccaagaacaagtatttgtttccagtatgaagtgtcagcagttcacaatcttcaacccacccagccaagtctcatacgaagattccagggtgtgtctttacctgttcacttaagagcacattttacaatatgggataagctattggaaagatctcggaaaatggtaactgaagatcaaagtaaagcaacagaggaatgtacatctacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dehydrodolichyl diphosphate synthase
- leucine carboxyl methyltransferase 1
- torsin family 1, member B (torsin B)
- proline-rich transmembrane protein 2

Buy MRPL39-mitochondrial ribosomal protein L39 Gene now

Add to cart