Login to display prices
Login to display prices
LCMT1-leucine carboxyl methyltransferase 1 Gene View larger

LCMT1-leucine carboxyl methyltransferase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LCMT1-leucine carboxyl methyltransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LCMT1-leucine carboxyl methyltransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001214
Product type: DNA & cDNA
Ncbi symbol: LCMT1
Origin species: Human
Product name: LCMT1-leucine carboxyl methyltransferase 1 Gene
Size: 2ug
Accessions: BC001214
Gene id: 51451
Gene description: leucine carboxyl methyltransferase 1
Synonyms: CGI-68; LCMT; PPMT1; leucine carboxyl methyltransferase 1; [Phosphatase 2A protein]-leucine-carboxy methyltransferase 1; [phosphatase 2A protein]-leucine-carboxy methyltransferase; protein phosphatase methyltransferase 1; protein-leucine O-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccactaggcagagggaatcctctatcacctcctgctgttccacctcgagctgcgacgcagacgacgagggcgtgcgcggcacctgcgaagatgcttccctgtgcaagaggtttgcagtaagcattggctactggcatgacccttacatacagcactttgtgagactgtctaaagagaggaaagcccctgaaatcaacagaggatattttgctcgagtccatggtgtcagtcagcttataaaggcatttctacggaagacagaatgtcattgtcaaattgtcaaccttggggcaggcatggataccaccttctggagattaaaggatgaagatcttctcccaagtaaatattttgaggttgactttccaatgattgtcacgagaaagctgcacagtatcaaatgcaagcctcccctatccagccccattctagaactgcattcagaggacacacttcagatggatggacacatactggattcaaagagatatgccgttattggagcagatctccgagacctgtctgaactggaagagaagctaaagaaatgtaacatgaatacacaattgccaacactcctgatagctgaatgtgtgctggtttacatgactccagagcagtccgcaaacctcctgaagtgggcagccaacagttttgagagagccatgttcataaactacgaacaggtgaacatgggtgatcggtttgggcagatcatgattgaaaacctgcggagacgccagtgtgacctggcgggagtggagacctgcaagtcattagagtcacagaaagaacggctcctgtcgaatgggtgggaaacagcatcggccgtcgacatgatggagttgtacaacaggttacctcgagctgaagtgagcaggatagaatcacttgaattcctggatgaaatggagctgctggagcagctcatgcggcattactgcctttgctgggcaaccaaaggaggaaatgagcttgggctgaaggagataacttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - torsin family 1, member B (torsin B)
- proline-rich transmembrane protein 2
- zinc finger, DHHC-type containing 4
- chromosome 3 open reading frame 37