Login to display prices
Login to display prices
PRRT2-proline-rich transmembrane protein 2 Gene View larger

PRRT2-proline-rich transmembrane protein 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRRT2-proline-rich transmembrane protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRRT2-proline-rich transmembrane protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011405
Product type: DNA & cDNA
Ncbi symbol: PRRT2
Origin species: Human
Product name: PRRT2-proline-rich transmembrane protein 2 Gene
Size: 2ug
Accessions: BC011405
Gene id: 112476
Gene description: proline-rich transmembrane protein 2
Synonyms: BFIC2; BFIS2; DSPB3; DYT10; EKD1; FICCA; ICCA; IFITMD1; PKC; proline-rich transmembrane protein 2; dispanin subfamily B member 3; dystonia 10; infantile convulsions and paroxysmal choreoathetosis; interferon induced transmembrane protein domain containing 1; proline rich transmembrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccagcagctctgagatctctgagatgaagggggttgaggagagtcccaaggttccaggcgaagggcctggccattctgaagctgaaactggccctccccaggtcctagcaggggtaccagaccagccagaggccccgcagccaggtccaaacaccactgcggcccctgtggactcagggcccaaggctgggctggctccagaaaccacagagaccccggctggggcctcagaaacagcccaggccacagacctcagcttaagcccaggaggggaatcaaaggccaactgcagccccgaagacccatgccaagaaacagtgtccaaaccagaagtgagcaaagaggccactgcagaccaggggtccaggctggagtctgcagccccacctgaaccagccccagagcctgctccccaaccagacccccggccagattcccagccttcccccaagccagcccttcaaccagagctccctacccaggaggaccccacccctgagattctgtctgagagtgtaggggaaaagcaagagaatggggcagtggtgcccctgcaggctggtgatggggaagagggcccagcccctgagcctcactcaccaccctcaaaaaaatcccccccagccaatggggcccccccccgagtgctgcagcagctggttgaggaggatcgaatgagaagggcacacagtgggcatccaggatctccccgaggtagcctgagccgccaccccagctcccagctggcaggtcctggggtggaggggggtgaaggcacccagaaacctcgggactacatcatccttgccatcctgtcctgcttctgccccatgtggcctgtcaacatcgtggccttcgcttatgctgtcatgtcccggaacagcctgcagcagggggacgtggacggggcccagcgtctgggccgggtagccaagctcttaagcatcgtggcgctggtggggggagtcctcatcatcatcgcctcctgcgtcatcaacttaggcgtgtataagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, DHHC-type containing 4
- chromosome 3 open reading frame 37
- chemokine (C-X3-C motif) receptor 1
- peroxisomal D3,D2-enoyl-CoA isomerase