TOR1B-torsin family 1, member B (torsin B) Gene View larger

TOR1B-torsin family 1, member B (torsin B) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOR1B-torsin family 1, member B (torsin B) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TOR1B-torsin family 1, member B (torsin B) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015578
Product type: DNA & cDNA
Ncbi symbol: TOR1B
Origin species: Human
Product name: TOR1B-torsin family 1, member B (torsin B) Gene
Size: 2ug
Accessions: BC015578
Gene id: 27348
Gene description: torsin family 1, member B (torsin B)
Synonyms: DQ1; torsin-1B; torsin ATPase-1B; torsin B; torsin family 1 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcgggctgggtggctccggggcgcggcggcgctggcgctgctgctggcggcccgagtggtggcggcgttcgagcccatcaccgtgggcctagccatcggggccgcgtcggccatcaccggctacctgtcctacaatgacatctactgccgcttcgccgagtgctgccgcgaggagcggccgctcaacgcttcggctctcaagctggatttggaggagaagctgtttggacagcatctagccacggaagtgattttcaaggcgctgactggcttcaggaacaacaaaaatcccaagaaaccactgaccctttccttacacggctgggctggcacaggcaagaattttgtcagtcaaattgtggctgaaaatcttcacccaaaaggtctgaagagtaactttgtccacctgtttgtatcgactctgcacttccctcatgagcagaagataaaactgtaccaggaccagttacagaagtggatccgcggtaatgtgagtgcatgtgcgaactctgttttcatatttgacgagatggataaattgcaccccgggatcattgacgcaatcaagccgtttctagactactacgagcaggttgacggagtgtcttaccgcaaagccatcttcatctttctcagcaatgcaggcggggaccttataactaagacggctcttgacttttggcgggccggaagaaagagggaagacattcagctgaaggacctggaacctgtactgtctgtcggagtcttcaataataaacacagtggcctgtggcacagtggactgatcgacaaaaacctcattgattactttatccccttcctgcctttggagtacagacatgtgaaaatgtgtgtgagggccgagatgagggcccgtggttctgccatagatgaagacattgtcacaagagtggcagaggaaatgacgtttttccccagagacgagaaaatctactcagacaagggctgcaagactgtgcagtcgcggctggatttccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline-rich transmembrane protein 2
- zinc finger, DHHC-type containing 4
- chromosome 3 open reading frame 37
- chemokine (C-X3-C motif) receptor 1

Buy TOR1B-torsin family 1, member B (torsin B) Gene now

Add to cart