DHDDS-dehydrodolichyl diphosphate synthase Gene View larger

DHDDS-dehydrodolichyl diphosphate synthase Gene

PTXBC003643

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHDDS-dehydrodolichyl diphosphate synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DHDDS-dehydrodolichyl diphosphate synthase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003643
Product type: DNA & cDNA
Ncbi symbol: DHDDS
Origin species: Human
Product name: DHDDS-dehydrodolichyl diphosphate synthase Gene
Size: 2ug
Accessions: BC003643
Gene id: 79947
Gene description: dehydrodolichyl diphosphate synthase
Synonyms: dehydrodolichyl diphosphate syntase complex subunit DHDDS; dehydrodolichyl diphosphate synthase complex subunit DHDDS; CIT; CPT; HDS; RP59; cis-IPTase; cis-isoprenyltransferase; cis-prenyl transferase; dedol-PP synthase; epididymis tissue protein Li 189m; dehydrodolichyl diphosphate synthase subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatggatcaaggaaggagagctgtcactttgggagcggttctgtgccaacatcataaaggcaggcccaatgccgaaacacattgcattcataatggacgggaaccgtcgctatgccaagaagtgccaggtggagcggcaggaaggccactcacagggcttcaacaagctagctgagactctgcggtggtgtttgaacctgggcatcctagaggtgacagtctacgcattcagcattgagaacttcaaacgctccaagagtgaggtagacgggcttatggatctggcccggcagaagttcagccgcttgatggaagaaaaggagaaactgcagaagcatggggtgtgtatccgggtcctgggcgatctgcacttgttgcccttggatctccaggagctgattgcacaagctgtacaggccacgaagaactacaacaagtgtttcctgaatgtctgttttgcatacacatcccgtcatgagatcagcaatgctgtgagagagatggcctggggggtggagcaaggcctgttggatcccagtgatatctctgagtctctgcttgataagtgcctctataccaaccgctctcctcatcctgacatcttgatacggacttctggagaagtgcggctgagtgacttcttgctatggcagacctctcactcctgcctggtgttccaacccgttctgtggccagagtatacattttggaacctcttcgaggccatcctgcagttccagatgaaccatagcatgcttcagaaggcccgagacatgtatgcagaggagcggaagaggcagcagctggagagggaccaggctacagtgacagagcagctgctgcgagaggggctccaagccagtggggacgcccagctccgaaggacacgcttgcacaaactctcggccagacgggaagagcgagtccaaggcttcctgcaggccttggaactcaagcgagctgactggctggcccgtctgggcactgcatcagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine carboxyl methyltransferase 1
- torsin family 1, member B (torsin B)
- proline-rich transmembrane protein 2
- zinc finger, DHHC-type containing 4

Buy DHDDS-dehydrodolichyl diphosphate synthase Gene now

Add to cart