C3orf38-chromosome 3 open reading frame 38 Gene View larger

C3orf38-chromosome 3 open reading frame 38 Gene

PTXBC024188

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf38-chromosome 3 open reading frame 38 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf38-chromosome 3 open reading frame 38 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024188
Product type: DNA & cDNA
Ncbi symbol: C3orf38
Origin species: Human
Product name: C3orf38-chromosome 3 open reading frame 38 Gene
Size: 2ug
Accessions: BC024188
Gene id: 285237
Gene description: chromosome 3 open reading frame 38
Synonyms: uncharacterized protein C3orf38; chromosome 3 open reading frame 38
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggactcagcttttcagagatggagggctgccgtaacctacttggcctactggacaacgacgagatcatggccctatgcgacaccgtcaccaaccgcctggtgcagcctcaggaccgccaagatgctgttcatgcaatattagcatacagtcaaagtgcagaagaacttctgaggcgtagaaaagtccaccgagaagttatatttaagtacttggcaacacaggggattgttatacctccagctactgaaaaacacaatcttattcagcatgcaaaagattactggcaaaagcaaccacaactgaaattgaaggaaacgccagagccagttacaaagacagaggacatccacctatttcaacagcaggtgaaagaagataaaaaagctgaaaaagttgattttcgtcgcctaggagaagaattctgtcattggttctttggacttcttaattctcagaatccttttctaggaccacctcaagatgaatggggaccacagcacttctggcatgatgtgaagcttaggttttattacaacacatcagaacaaaatgttatggactaccatggagcagaaatcgtgagccttcgtttgctgtcactagtaaaagaagaatttctttttctcagccccaacctagattcacatggactgaaatgtgcatcttctcctcatgggctggttatggttggagttgctgggactgtccatcgaggaaacacttgtttgggcatttttgaacaaatttttggactcatccgctgcccttttgtggagaatacttggaaaatcaaatttatcaacctgaaaattatgggagagagttcccttgctcctggaacattaccgaaaccatctgttaaatttgaacaaagtgatctagaggccttttataatgtaatcactgtatgtggtaccaatgaagtacgacataatgtaaagcaggcttcggatagtggaactggggaccaagtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L39
- dehydrodolichyl diphosphate synthase
- leucine carboxyl methyltransferase 1
- torsin family 1, member B (torsin B)

Buy C3orf38-chromosome 3 open reading frame 38 Gene now

Add to cart