FBXL12-F-box and leucine-rich repeat protein 12 Gene View larger

FBXL12-F-box and leucine-rich repeat protein 12 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBXL12-F-box and leucine-rich repeat protein 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FBXL12-F-box and leucine-rich repeat protein 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001586
Product type: DNA & cDNA
Ncbi symbol: FBXL12
Origin species: Human
Product name: FBXL12-F-box and leucine-rich repeat protein 12 Gene
Size: 2ug
Accessions: BC001586
Gene id: 54850
Gene description: F-box and leucine-rich repeat protein 12
Synonyms: Fbl12; F-box/LRR-repeat protein 12; F-box protein FBL12; F-box and leucine rich repeat protein 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactttggtcgaactgccggactcggtcctgctcgagatcttctcttacctcccggtacgggaccggatccgcatctccagggtctgtcaccgctggaagaggctggtggacgaccggtggctgtggcgacatgtcgacctgacgctctacacgatgcgacctaaagtcatgtggcacctccttcgaaggtacatggcatcccggctccattccctgcggatgggtggctacctgttctctggctcccaggccccccagttgtcccctgctctgttgagagccctgggccagaagtgccccaacctgaagcgcctctgcctgcatgtggccgacctgagcatggtgcccatcaccagcctgcccagcaccttgaggaccctggagctgcacagctgcgagatctccatggcctggctccacaagcagcaggaccccaccgtgctgcccctgcttgaatgcatcgtgctggaccgcgtccccgccttccgtgacgagcacctgcagggcctgacgcgcttccgggccttgcgctcgctggtgctgggtggtacctaccgtgtgaccgagacagggctggatgctggcctgcaggagctcagctatctgcagaggcttgaggtgctgggctgcaccctgtctgccgacagcaccctgctggccatcagccgccacctccgagatgtgcgcaagatccggctgaccgtgaggggcctctctgcccctggcctggctgtgctggagggaatgccggccctggagagtctgtgcctgcagggtcccctcgtcaccccagaaatgccctcccccactgaaatcctctcctcctgcctcactatgcccaagctcagagtccttgagctgcaggggctggggtgggagggtcaggaggcggagaagatcctgtgtaaggggctgccccactgtatggtcatcgtcagggcttgccccaaagagtctatggactggtggatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dystrophia myotonica, WD repeat containing
- plasminogen activator, urokinase receptor
- neuroblastoma breakpoint family, member 3
- zinc finger protein 36, C3H type-like 1

Buy FBXL12-F-box and leucine-rich repeat protein 12 Gene now

Add to cart