NBPF3-neuroblastoma breakpoint family, member 3 Gene View larger

NBPF3-neuroblastoma breakpoint family, member 3 Gene

PTXBC024011

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NBPF3-neuroblastoma breakpoint family, member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NBPF3-neuroblastoma breakpoint family, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024011
Product type: DNA & cDNA
Ncbi symbol: NBPF3
Origin species: Human
Product name: NBPF3-neuroblastoma breakpoint family, member 3 Gene
Size: 2ug
Accessions: BC024011
Gene id: 84224
Gene description: neuroblastoma breakpoint family, member 3
Synonyms: AE2; neuroblastoma breakpoint family member 3; protein SHIIIa4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccactgactcccactgtccagggcttccagtggactctccgaggccctgatgtagaaacttccccattcggtgcaccaagagcagcctcacatggtgtgggccgacatcaagagctgcgagatccaacagtccctggccccacctcttctgccacaaacgtcagcatggtggtatctgccggcccttggtccggtgagaaggcagagatgaacattctagaaatcaacaagaaatcgcgcccccagctggcagagaacaaacagcagttcagaaacctcaaacagaaatgtcttgtaactcaagtggcctacttcctggccaaccggcaaaataattgcgactatgaagactgcaaagacctcataaaatctatgctgagggatgagcggctgctcacagaagagaagcttgcagaggagctcgggcaagctgaggagctcaggcaatataaagtcctggttcactctcaggaacgagagctgacccagttaagggagaagttacaggaagggagagatgcctcccgctcattgaatcagcatctccaggccctcctcactccggatgagccggacaactcccagggacgggacctccgagaacagctggctgagggatgtaggctggcacagcacctcgtccaaaagctcagcccagaaaatgatgacgatgaggatgaagatgttaaagttgaggaggctgagaaagtacaggaattatatgcccccagggaggtgcagaaggctgaagaaaggaagtccctgaggactcactggaggagtatgccatcacttgttcaaatagccaccacccttgtgagtccaaccagccttacgggaacaccagaatcacatttgaggaagaccaagtcgactcaactctcattgactcatcctctcatgatgaatggttggatgctgtatgcattatcccagaaaatgaaagtgatcatgagcaagaggaagaaaaagggccagtgtctcccagatcatctggaaggttttgttgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 36, C3H type-like 1
- non-SMC condensin II complex, subunit D3
- cAMP responsive element binding protein 1
- CD2 (cytoplasmic tail) binding protein 2

Buy NBPF3-neuroblastoma breakpoint family, member 3 Gene now

Add to cart