ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene View larger

ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018340
Product type: DNA & cDNA
Ncbi symbol: ZFP36L1
Origin species: Human
Product name: ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene
Size: 2ug
Accessions: BC018340
Gene id: 677
Gene description: zinc finger protein 36, C3H type-like 1
Synonyms: mRNA decay activator protein ZFP36L1; BRF1; Berg36; ERF-1; ERF1; RNF162B; TIS11B; cMG1; EGF-response factor 1; TPA-induced sequence 11b; ZFP36-like 1; butyrate response factor 1; early response factor Berg36; zinc finger protein 36, C3H type-like 1; zinc finger protein 36, C3H1 type-like 1; zinc finger protein, C3H type, 36-like 1; ZFP36 ring finger protein like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaccaccctcgtgtctgccaccatcttcgacttgagcgaagttttatgcaagggtaacaagatgctcaactatagtgctcccagtgcagggggttgcctgctggacagaaaggcagtgggcacccctgctggtgggggcttccctcggaggcactcagtcaccctgcccagctccaagttccaccagaaccagctcctcagcagcctcaagggtgagccagcccccgctctgagctcgcgagacagccgcttccgagaccgctccttctcggaagggggcgagcggctgctgcccacccagaagcagcccgggggcggccaggtcaactccagccgctacaagacggagctgtgccgcccctttgaggaaaacggtgcctgtaagtacggggacaagtgccagttcgcacacggcatccacgagctccgcagcctgacccgccaccccaagtacaagacggagctgtgccgcaccttccacaccatcggcttttgcccctacgggccccgctgccacttcatccacaacgctgaagagcgccgtgccctggccggggcccgggacctctccgctgaccgtccccgcctccagcatagctttagctttgctgggtttcccagtgccgctgccaccgccgctgccaccgggctgctggacagccccacgtccatcaccccaccccctattctgagcgccgatgacctcctgggctcacctaccctgcccgatggcaccaataacccttttgccttctccagccaggagctggcaagcctctttgcccctagcatggggctgcccgggggtggctccccgaccaccttcctcttccggcccatgtccgagtcccctcacatgtttgactctccccccagccctcaggattctctctcggaccaggagggctacctgagcagctccagcagcagccacagtggctcagactccccgaccttggacaactcaagacgcctgcccatcttcagcagactttccatctcagatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-SMC condensin II complex, subunit D3
- cAMP responsive element binding protein 1
- CD2 (cytoplasmic tail) binding protein 2
- sterile alpha motif domain containing 4A

Buy ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene now

Add to cart