Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CD2BP2-CD2 (cytoplasmic tail) binding protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD2BP2-CD2 (cytoplasmic tail) binding protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000495 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD2BP2 |
| Origin species: | Human |
| Product name: | CD2BP2-CD2 (cytoplasmic tail) binding protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC000495 |
| Gene id: | 10421 |
| Gene description: | CD2 (cytoplasmic tail) binding protein 2 |
| Synonyms: | FWP010; LIN1; PPP1R59; Snu40; U5-52K; CD2 antigen cytoplasmic tail-binding protein 2; CD2 cytoplasmic domain-binding protein 2; U5 snRNP 52K protein; protein phosphatase 1, regulatory subunit 59; CD2 cytoplasmic tail binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaaagaggaaagtgaccttccaaggcgtgggagatgaggaggatgaggatgaaatcattgtccccaagaagaagctggtggaccctgtggctgggtcagggggtcctgggagccgctttaaaggcaaacactctttggatagcgatgaggaggaggatgatgatgatggggggtccagcaaatatgacatcttggcctcagaggatgtagaaggtcaggaggcagccacactccccagcgaggggggtgttcggatcacaccctttaacctgcaggaggagatggaggaaggccactttgatgccgatggcaactacttcctgaaccgggatgctcagatccgagacagctggctggacaacattgactgggtgaagatccgggagcggccacctggccagcgccaggcctcagactcggaggaggaggacagcttgggccagacctcaatgagtgcccaagccctcttggagggacttttggagctcctattgcctagagagacagtggctggggcactgaggcgtctgggggcccgaggaggaggcaaagggagaaaggggcctgggcaacccagttcccctcagcgcctggaccggctctccgggttggccgaccagatggtggcccggggcaaccttggtgtgtaccaggaaacaagggaacggttggctatgcgtctgaagggtttggggtgtcagaccctaggaccccacaatcccacacccccaccctccctggacatgttcgctgaggagttggcggaggaggaactggagaccccaacccctacccagagaggagaagcagagtcgcggggagatggtctggtggatgtgatgtgggaatataagtgggagaacacgggggatgccgagctgtatgggcccttcaccagcgcccagatgcagacctgggtgagtgaaggctacttcccggacggtgtttattgccggaagctggacccccctggtggtcagttctacaactccaaacgcattgactttgacctctacacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sterile alpha motif domain containing 4A - glutamate receptor, ionotropic, kainate 2 - carboxypeptidase X (M14 family), member 1 - zinc finger and BTB domain containing 47 |