GRIK2-glutamate receptor, ionotropic, kainate 2 Gene View larger

GRIK2-glutamate receptor, ionotropic, kainate 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRIK2-glutamate receptor, ionotropic, kainate 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GRIK2-glutamate receptor, ionotropic, kainate 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC037954
Product type: DNA & cDNA
Ncbi symbol: GRIK2
Origin species: Human
Product name: GRIK2-glutamate receptor, ionotropic, kainate 2 Gene
Size: 2ug
Accessions: BC037954
Gene id: 2898
Gene description: glutamate receptor, ionotropic, kainate 2
Synonyms: EAA4; GLR6; GLUK6; GLUR6; GluK2; MRT6; glutamate receptor ionotropic, kainate 2; bA487F5.1; excitatory amino acid receptor 4; gluR-6; glutamate receptor 6; glutamate receptor form A; glutamate receptor form B; glutamate receptor form C; glutamate receptor form D; glutamate receptor form E; glutamate ionotropic receptor kainate type subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carboxypeptidase X (M14 family), member 1
- zinc finger and BTB domain containing 47
- cAMP responsive element binding protein 3
- MHC class I polypeptide-related sequence A

Buy GRIK2-glutamate receptor, ionotropic, kainate 2 Gene now

Add to cart