Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GRIK2-glutamate receptor, ionotropic, kainate 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GRIK2-glutamate receptor, ionotropic, kainate 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037954 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GRIK2 |
| Origin species: | Human |
| Product name: | GRIK2-glutamate receptor, ionotropic, kainate 2 Gene |
| Size: | 2ug |
| Accessions: | BC037954 |
| Gene id: | 2898 |
| Gene description: | glutamate receptor, ionotropic, kainate 2 |
| Synonyms: | EAA4; GLR6; GLUK6; GLUR6; GluK2; MRT6; glutamate receptor ionotropic, kainate 2; bA487F5.1; excitatory amino acid receptor 4; gluR-6; glutamate receptor 6; glutamate receptor form A; glutamate receptor form B; glutamate receptor form C; glutamate receptor form D; glutamate receptor form E; glutamate ionotropic receptor kainate type subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carboxypeptidase X (M14 family), member 1 - zinc finger and BTB domain containing 47 - cAMP responsive element binding protein 3 - MHC class I polypeptide-related sequence A |