Login to display prices
Login to display prices
GRIK2-glutamate receptor, ionotropic, kainate 2 Gene View larger

GRIK2-glutamate receptor, ionotropic, kainate 2 Gene

PTXBC037954

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRIK2-glutamate receptor, ionotropic, kainate 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GRIK2-glutamate receptor, ionotropic, kainate 2 Gene

Proteogenix catalog: PTXBC037954
Ncbi symbol: GRIK2
Product name: GRIK2-glutamate receptor, ionotropic, kainate 2 Gene
Size: 2ug
Accessions: BC037954
Gene id: 2898
Gene description: glutamate receptor, ionotropic, kainate 2
Synonyms: EAA4; GLR6; GLUK6; GLUR6; GluK2; MRT6; glutamate receptor ionotropic, kainate 2; bA487F5.1; excitatory amino acid receptor 4; gluR-6; glutamate receptor 6; glutamate receptor form A; glutamate receptor form B; glutamate receptor form C; glutamate receptor form D; glutamate receptor form E; glutamate ionotropic receptor kainate type subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: