CREB3-cAMP responsive element binding protein 3 Gene View larger

CREB3-cAMP responsive element binding protein 3 Gene

PTXBC009402

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CREB3-cAMP responsive element binding protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CREB3-cAMP responsive element binding protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009402
Product type: DNA & cDNA
Ncbi symbol: CREB3
Origin species: Human
Product name: CREB3-cAMP responsive element binding protein 3 Gene
Size: 2ug
Accessions: BC009402
Gene id: 10488
Gene description: cAMP responsive element binding protein 3
Synonyms: LUMAN; LZIP; sLZIP; cyclic AMP-responsive element-binding protein 3; basic leucine zipper protein; cyclic AMP response element (CRE)-binding protein/activating transcription factor 1; leucin zipper proitein; small leucine zipper protein; transcription factor LZIP-alpha; cAMP responsive element binding protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctggaattggatgctggtgaccaagacctgctggccttcctgctagaggaaagtggagatttggggacggcacccgatgaggccgtgagggccccactggactgggcgctgccgctttctgaggtaccgagcgactgggaagtagatgatttgctgtgctccctgctgagtcccccagcgtcgttgaacattctcagctcctccaacccctgccttgtccaccatgaccacacctactccctcccacgggaaactgtctctatggatctagagagtgagagctgtagaaaagaggggacccagatgactccacagcatatggaggagctggcagagcaggagattgctaggctagtactgacagatgaggagaagagtctattggagaaggaggggcttattctgcctgagacacttcctctcactaagacagaggaacaaattctgaaacgtgtgcggaggaagattcgaaataaaagatctgctcaagagagccgcaggaaaaagaaggtgtatgttgggggtttagagagcagggtcttgaaatacacagcccagaatatggagcttcagaacaaagtacagcttctggaggaacagaatttgtcccttctagatcaactgaggaaactccaggccatggtgattgagatatcaaacaaaaccagcagcagcagcacctgcatcttggtcctactagtctccttctgcctcctccttgtacctgctatttactcctctgacacaagggggagcctgccagctgagcatggagtgttgtcccgccagcttcgtgccctccccagtgaggacccttaccagctggagctgcctgccctgcagtcagaagtgccgaaagacagcacacaccagtggttggacggctcagactgtgtactccaggcccctggcaacacttcctgcctgctgcattacatgcctcaggctcccagtgcagagcctcccctggagtggccattccctgacctcttctcagagcctctctgccgaggtcccatcctccccctgcaggcaaatctcacaaggaagggaggatggcttcctactggtagcccctctgtcattttgcaggacagatactcaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MHC class I polypeptide-related sequence A
- peptidase (mitochondrial processing) beta
- choline/ethanolamine phosphotransferase 1
- F-box and leucine-rich repeat protein 14

Buy CREB3-cAMP responsive element binding protein 3 Gene now

Add to cart