CPXM1-carboxypeptidase X (M14 family), member 1 Gene View larger

CPXM1-carboxypeptidase X (M14 family), member 1 Gene

PTXBC032692

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPXM1-carboxypeptidase X (M14 family), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CPXM1-carboxypeptidase X (M14 family), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032692
Product type: DNA & cDNA
Ncbi symbol: CPXM1
Origin species: Human
Product name: CPXM1-carboxypeptidase X (M14 family), member 1 Gene
Size: 2ug
Accessions: BC032692
Gene id: 56265
Gene description: carboxypeptidase X (M14 family), member 1
Synonyms: CPX1; CPXM; carboxypeptidase X (M14 family), member 1; carboxypeptidase-like protein X1; metallocarboxypeptidase CPX-1; carboxypeptidase X, M14 family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggggctcctgctcgccctggccgccttcgcgccggccgtcggcccggctctgggggcgcccaggaactcggtgctgggcctcgcgcagcccgggaccaccaaggtcccaggctcgaccccggccctgcatagcagcccggcacagccgccggcggagacagctaacgggacctcagaacagcatgtccggattcgagtcatcaagaagaaaaaggtcattatgaagaagcggaagaagctaactctaactcgccccaccccactggtgactgccgggccccttgtgacccccactccagcagggaccctcgaccccgctgagaaacaagaaacaggctgtcctcctttgggtctggagtccctgcgagtttcagatagccggcttgaggcatccagcagccagtcctttggtcttggaccacaccgaggacggctcaacattcagtcaggcctggaggacggcgatctatatgatggagcctggtgtgctgaggagcaggacgccgatccatggtttcaggtggacgctgggcaccccacccgcttctcgggtgttatcacacagggcaggaactctgtctggaggtatgactgggtcacatcatacaaggtccagttcagcaatgacagtcggacctggtggggaagtaggaaccacagcagtgggatggacgcagtatttcctgccaattcagacccagaaactccagtgctgaacctcctgccggagccccaggtggcccgcttcattcgcctgctgccccagacctggctccagggaggcgcgccttgcctccgggcagagatcctggcctgcccagtctcagaccccaatgacctattccttgaggcccctgcgtcgggatcctctgaccctctagactttcagcatcacaattacaaggccatgaggaaggtcagatataacccctatgacctgggaaggagggcccacccatctcaggtccccttcccaccttcccaccggggcacaacctgctgtgactgcgcttgtatgcccctgctgcctcctgatgtctcagccttctctcctgtggacccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and BTB domain containing 47
- cAMP responsive element binding protein 3
- MHC class I polypeptide-related sequence A
- peptidase (mitochondrial processing) beta

Buy CPXM1-carboxypeptidase X (M14 family), member 1 Gene now

Add to cart