Login to display prices
Login to display prices
PLAUR-plasminogen activator, urokinase receptor Gene View larger

PLAUR-plasminogen activator, urokinase receptor Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLAUR-plasminogen activator, urokinase receptor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLAUR-plasminogen activator, urokinase receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002788
Product type: DNA & cDNA
Ncbi symbol: PLAUR
Origin species: Human
Product name: PLAUR-plasminogen activator, urokinase receptor Gene
Size: 2ug
Accessions: BC002788
Gene id: 5329
Gene description: plasminogen activator, urokinase receptor
Synonyms: CD87; U-PAR; URKR; urokinase plasminogen activator surface receptor; monocyte activation antigen Mo3; u-plasminogen activator receptor form 2; urokinase-type plasminogen activator (uPA) receptor; plasminogen activator, urokinase receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcacccgccgctgctgccgctgctgctgctgctccacacctgcgtcccagcctcttggggcctgcggtgcatgcagtgtaagaccaacggggattgccgtgtggaagagtgcgccctgggacaggacctctgcaggaccacgatcgtgcgcttgtgggaagaaggagaagagctggagctggtggagaaaagctgtacccactcagagaagaccaacaggaccctgagctatcggactggcttgaagatcaccagccttaccgaggttgtgtgtgggttagacttgtgcaaccagggcaactctggccgggctgtcacctattcccgaagccgttacctcgaatgcatttcctgtggctcatcagacatgagctgtgagaggggccggcaccagagcctgcagtgccgcagccctgaagaacagtgcctggatgtggtgacccactggatccaggaaggtgaagaagggcgtccaaaggatgaccgccacctccgtggctgtggctaccttcccggctgcccgggctccaatggtttccacaacaacgacaccttccacttcctgaaatgctgcaacaccaccaaatgcaacgagggcccaatcctggagcttgaaaatctgccgcagaatggccgccagtgttacagctgcaaggggaacagcacccatggatgctcctctgaagagactttcctcattgactgccgaggccccatgaatcaatgtctggtagccaccggcactcacgaaccgaaaaaccaaagctatatggtaagaggctgtgcaaccgcctcaatgtgccaacatgcccacctgggtgacgccttcagcatgaaccacattgatgtctcctgctgtactaaaagtggctgtaaccacccagacctggatgtccagtaccgcagtggggctgctcctcagcctggccctgcccatctcagcctcaccatcaccctgctaatgactgccagactgtggggaggcactctcctctggacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neuroblastoma breakpoint family, member 3
- zinc finger protein 36, C3H type-like 1
- non-SMC condensin II complex, subunit D3
- cAMP responsive element binding protein 1