DMWD-dystrophia myotonica, WD repeat containing Gene View larger

DMWD-dystrophia myotonica, WD repeat containing Gene

PTXBC019266

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DMWD-dystrophia myotonica, WD repeat containing Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DMWD-dystrophia myotonica, WD repeat containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019266
Product type: DNA & cDNA
Ncbi symbol: DMWD
Origin species: Human
Product name: DMWD-dystrophia myotonica, WD repeat containing Gene
Size: 2ug
Accessions: BC019266
Gene id: 1762
Gene description: dystrophia myotonica, WD repeat containing
Synonyms: D19S593E; DMR-N9; DMRN9; gene59; dystrophia myotonica WD repeat-containing protein; dystrophia myotonica-containing WD repeat motif protein; protein 59; dystrophia myotonica, WD repeat containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcctgcgtgggctcatgaagagctactttgggggcctgctgtgtgtgtgctggagccctgacggccgctacgtggtgacgggtggcgaagatgacctggtcaccgtgtggtccttcaccgagggccgcgtggtggctcgaggccatggccacaagtcctgggtcaacgctgtggcctttgacccctacaccacaagggcagaggaggcggcgacagcagccggtgctgatggggagcggagcggcgaagaggaggaggaggagcccgaggctgcgggcacaggctcggccgggggcgccccgctctctccactgcccaaggctggctccattacttaccgctttggctcggcgggccaggacacgcagttctgcctgtgggacctcactgaagacgtgctctacccgcacccgcccctggcccgcacccgcaccctccctggcacacctggcaccacgccaccggccgccagcagctcgaggggtggcgagcctggcccaggccccctgcctcgctcgctgtcccgctccaacagtctcccgcacccagctggcgggggcaaggcgggcggcccgggtgtggcggcagagcctggcacaccattcagcattggccgcttcgccacgctcacactgcaggagcggcgggaccggggggcagagaaggagcacaagcgctaccacagcctgggcaacatcagccggggtggcagtggcggcagtggcagtggtggggagaagcccagcggccctgttccccgcagccgcctggaccccgccaaggtgctgggcactgcgctgtgcccgcgcatccacgaggtgcccctgctggagccccttgtgtgcaagaagatcgcccaggagcggctcacagtcctcctgttcctggaggactgcatcatcactgcctgccaggagggcctcatctgcacctgggcccggccgggcaaggcgggcatctcctcccaaccaggcaactccccgagtggcacagtggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - plasminogen activator, urokinase receptor
- neuroblastoma breakpoint family, member 3
- zinc finger protein 36, C3H type-like 1
- non-SMC condensin II complex, subunit D3

Buy DMWD-dystrophia myotonica, WD repeat containing Gene now

Add to cart