SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene View larger

SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014051
Product type: DNA & cDNA
Ncbi symbol: SCYE1
Origin species: Human
Product name: SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene
Size: 2ug
Accessions: BC014051
Gene id: 9255
Gene description: small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)
Synonyms: SCYE1; EMAP2; EMAPII; HLD3; p43; aminoacyl tRNA synthase complex-interacting multifunctional protein 1; ARS-interacting multifunctional protein 1; endothelial monocyte-activating polypeptide 2; endothelial-monocyte activating polypeptide II; multisynthase complex auxiliary component p43; multisynthetase complex auxiliary component p43; small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating); aminoacyl tRNA synthetase complex interacting multifunctional protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaataatgatgctgttctgaagagactggagcagaagggtgcagaggcagatcaaatcattgaatatcttaagcagcaagtttctctacttaaggagaaagcaattttgcaggcaactttgagggaagagaagaaacttcgagttgaaaatgctaaactgaagaaagaaattgaagaactgaaacaagagctaattcaggcagaaattcaaaatggagtgaagcaaataccatttccatctggtactccactgcacgctaattctatggtttctgaaaatgtgatacagtctacagcagtaacaaccgtatcttctggtaccaaagaacagataaaaggaggaacaggagacgaaaagaaagcgaaagagaaaattgaaaagaaaggagagaagaaggagaaaaaacagcaatcaatagctggaagtgccgactctaagccaatagatgtttcccgtctggatcttcgaattggttgcatcataactgctagaaaacaccctgatgcagattctttgtatgtggaagaagtagatgtcggagaaatagccccaaggacagttgtcagtggcctggtgaatcatgttcctcttgaacagatgcaaaatcggatggtgattttactttgtaacctgaaacctgcaaagatgaggggagtattatctcaagcaatggtcatgtgtgctagttcaccagagaaaattgaaatcttggctcctccaaatgggtctgttcctggagacagaattacttttgatgctttcccaggagagcctgacaaggagctgaatcctaagaagaagatttgggagcagatccagcctgatcttcacactaatgatgagtgtgtggctacatacaaaggagttccctttgaggtgaaagggaagggagtatgtagggctcaaaccatgagcaacagtggaatcaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 7, (neutral amino acid transporter, y+ system) member 10
- myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type
- sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)

Buy SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene now

Add to cart