GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene View larger

GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000525
Product type: DNA & cDNA
Ncbi symbol: GOT2
Origin species: Human
Product name: GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene
Size: 2ug
Accessions: BC000525
Gene id: 2806
Gene description: glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
Synonyms: KAT4; KATIV; KYAT4; mitAAT; aspartate aminotransferase, mitochondrial; FABP-1; FABPpm; aspartate aminotransferase 2; aspartate transaminase 2; fatty acid-binding protein; glutamate oxaloacetate transaminase 2; glutamic-oxaloacetic transaminase 2, mitochondrial; kynurenine aminotransferase 4; kynurenine aminotransferase IV; kynurenine--oxoglutarate transaminase 4; kynurenine--oxoglutarate transaminase IV; mAspAT; plasma membrane-associated fatty acid-binding protein; transaminase A; glutamic-oxaloacetic transaminase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgctgcactccggccgcgtcctccccgggatcgccgccgccttccacccgggcctcgccgccgcggcctctgccagagccagctcctggtggacccatgtggaaatgggacctccagatcccattctgggagtcactgaagcctttaagagggacaccaatagcaaaaagatgaatctgggagttggtgcctaccgggatgataatggaaagccttacgttctgcctagcgtccgcaaggcagaggcccagattgccgcaaaaaatttggacaaggaatacctgcccattgggggactggctgaattttgcaaggcatctgcagaactagccctgggtgagaacagcgaagtcttgaagagtggccggtttgtcactgtgcagaccatttctggaactggagccttaaggatcggagccagttttctgcaaagattttttaagttcagccgagatgtctttctgcccaaaccaacctggggaaaccacacacccatcttcagggatgctggcatgcagctacaaggttatcggtattatgaccccaagacttgcggttttgacttcacaggcgctgtggaggatatttcaaaaataccagagcagagtgttcttcttctgcatgcctgcgcccacaatcccacgggagtggacccgcgtccggaacagtggaaggaaatagcaacagtggtgaagaaaaggaatctctttgcgttctttgacatggcctaccaaggctttgccagtggtgatggtgataaggatgcctgggctgtgcgccacttcatcgaacagggcattaatgtttgcctctgccaatcatatgccaagaacatgggcttatatggtgagcgtgtaggagccttcactatggtctgcaaagatgcggatgaagccaaaagggtagagtcacagttgaagatcttgatccgtcccatgtattccaaccctcccctcaatggggcccggattgctgctgccattctgaacaccccagatttgcgaaaacaatggctgcaagaagtgaaagtcatggctgaccgcatcattggcatgcggactcaactggtctccaacctcaagaaggagggttccacccacaattggcaacacatcaccgaccaaattggcatgttctgtttcacagggctaaagcctgaacaggtggagcggctgatcaaggagttctccatctacatgacaaaagatggccgcatctctgtggcaggggtcacctccagcaacgtgggctaccttgcccatgccattcaccaggccaccaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
- TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
- small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)
- solute carrier family 7, (neutral amino acid transporter, y+ system) member 10

Buy GOT2-glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Gene now

Add to cart