TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene View larger

TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009566
Product type: DNA & cDNA
Ncbi symbol: TAF9B
Origin species: Human
Product name: TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene
Size: 2ug
Accessions: BC009566
Gene id: 51616
Gene description: TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa
Synonyms: TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa; DN-7; DN7; TAFII31L; TFIID-31; transcription initiation factor TFIID subunit 9B; TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa; TBP-associated factor 9L; neuronal cell death-related protein 7; transcription initiation factor IID, 31kD subunit; transcription-associated factor TAFII31L; TATA-box binding protein associated factor 9b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtcgggcaagatggcgcctcccaagaacgctccgagagatgccttggtgatggcacagatcctgaaggatatgggaatcacagagtatgaaccaagggttataaatcaaatgttggaatttgctttccgttatgtgactacaattctggatgatgcaaaaatttattcgagccatgctaagaaacctaatgttgatgcagatgatgtgagactggcaatccagtgtcgtgctgaccaatcttttacctctcctcccccaagagattttttactggatatcgcaaggcagaaaaatcaaacccctttgccactgattaagccatatgcaggacctagactgccacctgatagatactgcttaacagctccaaactataggctgaagtccttaattaaaaagggacctaaccaagggagactagttccacgattaagtgttggtgctgttagtagcaaacctactactcctactatagcaaccccacaaacggtgtctgtcccaaataaagttgcaactccaatgtcagtgacaagccaaagatttacggtgcagattccaccttctcagtccacacctgtcaaaccagttcctgcaacaactgcagttcaaaatgttctgattaatccttcaatgattgggcccaaaaatattcttattaccaccaacatggtttcgtcacagaacacagccaatgaagcaaacccactgaagagaaaacatgaagatgatgatgacaatgatattatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)
- solute carrier family 7, (neutral amino acid transporter, y+ system) member 10
- myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)
- guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type

Buy TAF9B-TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa Gene now

Add to cart