Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MTHFS-5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) Gene
PTXBC019921
New product
Data sheet of MTHFS-5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTHFS-5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019921 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTHFS |
| Origin species: | Human |
| Product name: | MTHFS-5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) Gene |
| Size: | 2ug |
| Accessions: | BC019921 |
| Gene id: | 10588 |
| Gene description: | 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) |
| Synonyms: | HsT19268; 5-formyltetrahydrofolate cyclo-ligase; methenyl-THF synthetase; 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcagcggtgagcagcgccaagcgtagcctgcggggagagctgaagcagcgtctgcgggcgatgagtgccgaggagcggctacgccagtcccgcgtactgagccagaaggtgattgcccacagtgagtatcaaaagtccaaaagaatttccatctttctgagcatgcaagatgaaattgagacagaagagatcatcaaggacattttccaacgaggcaaaatctgcttcatccctcggtaccggttccagagcaatcacatggatatggtgagaatagaatcaccagaggaaatttctttacttcccaaaacatcctggaatatccctcagcctggtgagggtgatgttcgggaggaggccttgtccacagggggacttgatctcatcttcatgccaggccttgggtttgacaaacatggcaaccgactggggaggggcaagggctactatgatgcctatctgaagcgctgtttgcagcatcaggaagtgaagccctacaccctggcgttggctttcaaagaacagatttgcctccaggtcccagtgaatgaaaacgacatgaaggtagatgaagtcctttacgaagactcgtcaacagcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) - lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) - TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa - small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) |