Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene
PTXBC001416
New product
Data sheet of PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001416 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP4C |
| Origin species: | Human |
| Product name: | PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene |
| Size: | 2ug |
| Accessions: | BC001416 |
| Gene id: | 5531 |
| Gene description: | protein phosphatase 4 (formerly X), catalytic subunit |
| Synonyms: | PP-X; PP4; PP4C; PPH3; PPP4; PPX; serine/threonine-protein phosphatase 4 catalytic subunit; protein phosphatase 4 (formerly X), catalytic subunit; protein phosphatase X, catalytic subunit; protein phosphatase 4 catalytic subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagatcagcgacctggaccggcagatcgagcagctgcgtcgctgcgagctcatcaaggagagcgaagtcaaggccctgtgcgctaaggccagagagatcttggtagaggagagcaacgtgcagagggtggactcgccagtcacagtgtgcggcgacatccatggacaattctatgacctcaaagagctgttcagagtaggtggcgacgtccctgagaccaactacctcttcatgggggactttgtggaccgtggcttctatagcgtcgaaacgttcctcctgctgctggcacttaaggttcgctatcctgatcgcatcacactgatccggggcaaccatgagagtcgccagatcacgcaggtctatggcttctacgatgagtgcctgcgcaagtacggctcggtgactgtgtggcgctactgcactgagatctttgactacctcagcctgtcagccatcatcgatggcaagatcttctgcgtgcacgggggcctctccccctccatccagaccctggatcagattcggacaatcgaccgaaagcaagaggtgcctcatgatgggcccatgtgtgacctcctctggtctgacccagaagacaccacaggctggggcgtgagcccccgaggagccggctacctatttggcagtgacgtggtggcccagttcaacgcagccaatgacattgacatgatctgccgtgcccaccaactggtgatggaaggttacaagtggcacttcaatgagacggtgctcactgtgtggtcggcacccaactactgctaccgctgtgggaatgtggcagccatcttggagctggacgagcatctccagaaagatttcatcatctttgaggctgctccccaagagacacggggcatcccctccaagaagcccgtggccgactacttcctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carnosine dipeptidase 1 (metallopeptidase M20 family) - eukaryotic translation initiation factor 3, subunit I - TruB pseudouridine (psi) synthase homolog 2 (E. coli) - transcriptional adaptor 1 (HFI1 homolog, yeast)-like |