Login to display prices
Login to display prices
PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene View larger

PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001416
Product type: DNA & cDNA
Ncbi symbol: PPP4C
Origin species: Human
Product name: PPP4C-protein phosphatase 4 (formerly X), catalytic subunit Gene
Size: 2ug
Accessions: BC001416
Gene id: 5531
Gene description: protein phosphatase 4 (formerly X), catalytic subunit
Synonyms: PP-X; PP4; PP4C; PPH3; PPP4; PPX; serine/threonine-protein phosphatase 4 catalytic subunit; protein phosphatase 4 (formerly X), catalytic subunit; protein phosphatase X, catalytic subunit; protein phosphatase 4 catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagatcagcgacctggaccggcagatcgagcagctgcgtcgctgcgagctcatcaaggagagcgaagtcaaggccctgtgcgctaaggccagagagatcttggtagaggagagcaacgtgcagagggtggactcgccagtcacagtgtgcggcgacatccatggacaattctatgacctcaaagagctgttcagagtaggtggcgacgtccctgagaccaactacctcttcatgggggactttgtggaccgtggcttctatagcgtcgaaacgttcctcctgctgctggcacttaaggttcgctatcctgatcgcatcacactgatccggggcaaccatgagagtcgccagatcacgcaggtctatggcttctacgatgagtgcctgcgcaagtacggctcggtgactgtgtggcgctactgcactgagatctttgactacctcagcctgtcagccatcatcgatggcaagatcttctgcgtgcacgggggcctctccccctccatccagaccctggatcagattcggacaatcgaccgaaagcaagaggtgcctcatgatgggcccatgtgtgacctcctctggtctgacccagaagacaccacaggctggggcgtgagcccccgaggagccggctacctatttggcagtgacgtggtggcccagttcaacgcagccaatgacattgacatgatctgccgtgcccaccaactggtgatggaaggttacaagtggcacttcaatgagacggtgctcactgtgtggtcggcacccaactactgctaccgctgtgggaatgtggcagccatcttggagctggacgagcatctccagaaagatttcatcatctttgaggctgctccccaagagacacggggcatcccctccaagaagcccgtggccgactacttcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carnosine dipeptidase 1 (metallopeptidase M20 family)
- eukaryotic translation initiation factor 3, subunit I
- TruB pseudouridine (psi) synthase homolog 2 (E. coli)
- transcriptional adaptor 1 (HFI1 homolog, yeast)-like