CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene View larger

CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004271
Product type: DNA & cDNA
Ncbi symbol: CNDP1
Origin species: Human
Product name: CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene
Size: 2ug
Accessions: BC004271
Gene id: 84735
Gene description: carnosine dipeptidase 1 (metallopeptidase M20 family)
Synonyms: CN1; CPGL2; HsT2308; beta-Ala-His dipeptidase; CNDP dipeptidase 1; carnosinase 1; carnosine dipeptidase 1 (metallopeptidase M20 family); glutamate carboxypeptidase-like protein 2; serum carnosinase; carnosine dipeptidase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcagagaccaggattttcactcaggaacctttggtggcatccttcatgaaccaatggctgatctggttgctcttctcggtagcctggtagactcgtctggtcatatcctggtccctggaatctatgatgaagtggttcctcttacagaagaggaaataaatacatacaaagccatccatctagacctagaagaataccggaatagcagccgggttgagaaatttctgttcgatactaaggaggagattctaatgcacctctggaggtacccatctctttctattcatgggatcgagggcgcgtttgatgagcctggaactaaaacagtcatacctggccgagttataggaaaattttcaatccgtctagtccctcacatgaatgtgtctgcggtggaaaaacaggtgacacgacatcttgaagatgtgttctccaaaagaaatagttccaacaagatggttgtttccatgactctaggactacacccgtggattgcaaatattgatgacacccagtatctcgcagcaaaaagagcgatcagaacagtgtttggaacagaaccagatatgatccgggatggatccaccattccaattgccaaaatgttccaggagatcgtccacaagagcgtggtgctaattccgctgggagctgttgatgatggagaacattcgcagaatgagaaaatcaacaggtggaactacatagagggaaccaaattatttgctgcctttttcttagagatggcccagctccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 3, subunit I
- TruB pseudouridine (psi) synthase homolog 2 (E. coli)
- transcriptional adaptor 1 (HFI1 homolog, yeast)-like
- wingless-type MMTV integration site family, member 7A

Buy CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene now

Add to cart