Login to display prices
Login to display prices
CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene View larger

CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene

PTXBC004271

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene

Proteogenix catalog: PTXBC004271
Ncbi symbol: CNDP1
Product name: CNDP1-carnosine dipeptidase 1 (metallopeptidase M20 family) Gene
Size: 2ug
Accessions: BC004271
Gene id: 84735
Gene description: carnosine dipeptidase 1 (metallopeptidase M20 family)
Synonyms: CN1; CPGL2; HsT2308; beta-Ala-His dipeptidase; CNDP dipeptidase 1; carnosinase 1; carnosine dipeptidase 1 (metallopeptidase M20 family); glutamate carboxypeptidase-like protein 2; serum carnosinase; carnosine dipeptidase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcagagaccaggattttcactcaggaacctttggtggcatccttcatgaaccaatggctgatctggttgctcttctcggtagcctggtagactcgtctggtcatatcctggtccctggaatctatgatgaagtggttcctcttacagaagaggaaataaatacatacaaagccatccatctagacctagaagaataccggaatagcagccgggttgagaaatttctgttcgatactaaggaggagattctaatgcacctctggaggtacccatctctttctattcatgggatcgagggcgcgtttgatgagcctggaactaaaacagtcatacctggccgagttataggaaaattttcaatccgtctagtccctcacatgaatgtgtctgcggtggaaaaacaggtgacacgacatcttgaagatgtgttctccaaaagaaatagttccaacaagatggttgtttccatgactctaggactacacccgtggattgcaaatattgatgacacccagtatctcgcagcaaaaagagcgatcagaacagtgtttggaacagaaccagatatgatccgggatggatccaccattccaattgccaaaatgttccaggagatcgtccacaagagcgtggtgctaattccgctgggagctgttgatgatggagaacattcgcagaatgagaaaatcaacaggtggaactacatagagggaaccaaattatttgctgcctttttcttagagatggcccagctccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: