TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene View larger

TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001457
Product type: DNA & cDNA
Ncbi symbol: TRUB2
Origin species: Human
Product name: TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene
Size: 2ug
Accessions: BC001457
Gene id: 26995
Gene description: TruB pseudouridine (psi) synthase homolog 2 (E. coli)
Synonyms: CLONE24922; TruB pseudouridine (psi) synthase family member 2; TruB pseudouridine (psi) synthase homolog 2; TruB pseudouridine synthase family member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtctgctggcttgtcgcggctgcatgggcttttcgcggtctataagcccccggggctaaaatggaagcacctgcgggatacagtggagctacaacttctgaagggtctcaatgccaggaagcctcccgctcctaaacagcgtgttcgcttcttgctgggccccatggaaggcagcgaagagaaggagctgaccctcacagccaccagcgtaccctctttcatcaaccatccactggtatgtggaccagcattcgcccatctcaaggttggcgtgggacatcggttggatgcccaggcttctggagtacttgtgctcggcgtgggacatggatgcaggctcctcaccgatatgtacaatgctcatcttaccaaggattacacagtgcgtggcctcctgggcaaagctacagatgacttccgtgaggacgggaggctggtagagaagacaacctatgaccacgtgaccagagagaagctggaccgcattctggccgttatccaaggctcccatcagaaggccctggtgatgtactccaacctcgacctgaagacccaggaggcctatgagatggccgtgagaggcctgatccggcccatgaacaagtccccgatgctgataactggcatccgatgcctctactttgcacctccggaattcctcttagaggtgcagtgcatgcatgagacgcagaaagagctgcggaagttggttcatgaaatcggcctggaactaaagaccactgctgtctgcacccaagtgcggcgcacgcgcgacggcttcttcacgctagacagtgccctcctgaggacccagtgggacctaaccaacatccaggatgctatccgggctgctacccctcaggtagctgcagagctggagaagagcttgagcccggggctggacaccaagcagctccccagtccgggatggtcctgggactcccagggcccgagctctaccttggggctggagaggggtgcggggcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcriptional adaptor 1 (HFI1 homolog, yeast)-like
- wingless-type MMTV integration site family, member 7A
- actin related protein 2/3 complex, subunit 1B, 41kDa
- proline/arginine-rich end leucine-rich repeat protein

Buy TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene now

Add to cart