Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene
PTXBC001457
New product
Data sheet of TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001457 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRUB2 |
| Origin species: | Human |
| Product name: | TRUB2-TruB pseudouridine (psi) synthase homolog 2 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC001457 |
| Gene id: | 26995 |
| Gene description: | TruB pseudouridine (psi) synthase homolog 2 (E. coli) |
| Synonyms: | CLONE24922; TruB pseudouridine (psi) synthase family member 2; TruB pseudouridine (psi) synthase homolog 2; TruB pseudouridine synthase family member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtctgctggcttgtcgcggctgcatgggcttttcgcggtctataagcccccggggctaaaatggaagcacctgcgggatacagtggagctacaacttctgaagggtctcaatgccaggaagcctcccgctcctaaacagcgtgttcgcttcttgctgggccccatggaaggcagcgaagagaaggagctgaccctcacagccaccagcgtaccctctttcatcaaccatccactggtatgtggaccagcattcgcccatctcaaggttggcgtgggacatcggttggatgcccaggcttctggagtacttgtgctcggcgtgggacatggatgcaggctcctcaccgatatgtacaatgctcatcttaccaaggattacacagtgcgtggcctcctgggcaaagctacagatgacttccgtgaggacgggaggctggtagagaagacaacctatgaccacgtgaccagagagaagctggaccgcattctggccgttatccaaggctcccatcagaaggccctggtgatgtactccaacctcgacctgaagacccaggaggcctatgagatggccgtgagaggcctgatccggcccatgaacaagtccccgatgctgataactggcatccgatgcctctactttgcacctccggaattcctcttagaggtgcagtgcatgcatgagacgcagaaagagctgcggaagttggttcatgaaatcggcctggaactaaagaccactgctgtctgcacccaagtgcggcgcacgcgcgacggcttcttcacgctagacagtgccctcctgaggacccagtgggacctaaccaacatccaggatgctatccgggctgctacccctcaggtagctgcagagctggagaagagcttgagcccggggctggacaccaagcagctccccagtccgggatggtcctgggactcccagggcccgagctctaccttggggctggagaggggtgcggggcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcriptional adaptor 1 (HFI1 homolog, yeast)-like - wingless-type MMTV integration site family, member 7A - actin related protein 2/3 complex, subunit 1B, 41kDa - proline/arginine-rich end leucine-rich repeat protein |