Cart 1 Product Products 113,40 € (empty)
-
1 x ATAD3C-ATP...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
TADA1L-transcriptional adaptor 1 (HFI1 homolog, yeast)-like Gene
PTXBC015401
New product
Data sheet of TADA1L-transcriptional adaptor 1 (HFI1 homolog, yeast)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TADA1L-transcriptional adaptor 1 (HFI1 homolog, yeast)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015401 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TADA1L |
| Origin species: | Human |
| Product name: | TADA1L-transcriptional adaptor 1 (HFI1 homolog, yeast)-like Gene |
| Size: | 2ug |
| Accessions: | BC015401 |
| Gene id: | 117143 |
| Gene description: | transcriptional adaptor 1 (HFI1 homolog, yeast)-like |
| Synonyms: | TADA1L; ADA1; HFI1; STAF42; hADA1; transcriptional adapter 1; SPT3-associated factor 42 (STAF42); transcriptional adapter 1-like protein; transcriptional adaptor 1 (HFI1 homolog, yeast); transcriptional adaptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgacctttgtgagcgagctggaggcggccaagaagaacttaagcgaggccctgggggacaacgtgaaacaatactgggctaacctaaagctgtggttcaagcagaagatcagcaaagaggagtttgaccttgaagctcatagacttctcacacaggataatgtccattctcacaatgatttcctcctggccattctcacgcgttgtcagattttggtttctacaccagatggtgctggatctttgccttggccagggggttccgcagcaaaacctggaaaacccaagggaaagaaaaagctttcttctgttcgtcagaaatttgatcatagattccagcctcaaaatcctctctcaggagcccagcaatttgtggcaaaggatccccaagatgatgacgacttgaaactttgttcccacacaatgatgcttcccactcgaggccagcttgaagggagaatgatagtgactgcttatgagcatgggctggacaatgtcaccgaggaggctgtttcagctgttgtctatgctgtggagaatcaccttaaagatatactgacgtcagttgtgtcaagaaggaaagcttatcggttacgagatggtcattttaaatatgcctttggcagtaacgtgaccccgcagccatacctgaagaatagtgtagtagcttacaacaacttaatagaaagccctccagcttttactgctccctgtgctggtcagaatccagcttctcacccaccccctgatgatgctgagcagcaggctgcactcctgctggcatgctccggagacactctacctgcatctttgcctccggtgaacatgtacgatctttttgaagctttgcaggtgcacagggaagtcatccctacacatactgtctatgctcttaacattgaaaggatcatcacgaaactctggcatccaaatcatgaagagctgcagcaagacaaagttcaccgccagcgcttggcagccaaggaggggcttttgctgtgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 7A - actin related protein 2/3 complex, subunit 1B, 41kDa - proline/arginine-rich end leucine-rich repeat protein - eukaryotic translation initiation factor 3, subunit E |