Login to display prices
Login to display prices
EIF3E-eukaryotic translation initiation factor 3, subunit E Gene View larger

EIF3E-eukaryotic translation initiation factor 3, subunit E Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3E-eukaryotic translation initiation factor 3, subunit E Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3E-eukaryotic translation initiation factor 3, subunit E Gene

Proteogenix catalog: PTXBC005944
Ncbi symbol: EIF3E
Product name: EIF3E-eukaryotic translation initiation factor 3, subunit E Gene
Size: 2ug
Accessions: BC005944
Gene id: 3646
Gene description: eukaryotic translation initiation factor 3, subunit E
Synonyms: EIF3-P48; EIF3S6; INT6; eIF3-p46; eukaryotic translation initiation factor 3 subunit E; eIF-3 p48; eukaryotic translation initiation factor 3 subunit 6; eukaryotic translation initiation factor 3 subunit E isoform 2 transcript; eukaryotic translation initiation factor 3, subunit 6 (48kD); eukaryotic translation initiation factor 3, subunit 6 48kDa; mammary tumor-associated protein INT6; murine mammary tumor integration site 6 (oncogene homolog); viral integration site protein INT-6 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagactttgctatggatgtatacaaaaacctttattctgatgatattcctcatgctttgagagagaaaagaaccacagtggttgcacaactgaaacagcttcaggcagaaacagaaccaattgtgaagatgtttgaagatccagaaactacaaggcaaatgcagtcaaccagggatggtaggatgctctttgactacctggcggacaagcatggttttaggcaggaatatttagatacactctacagatatgcaaaattccagtacgaatgtgggaattactcaggagcagcagaatatctttatttttttagagtgctggttccagcaacagatagaaatgctttaagttcactctggggaaagctggcctctgaaatcttaatgcagaattgggatgcagccatggaagaccttacacggttaaaagagaccatagataataattctgtgagttctccacttcagtctcttcagcagagaacatggctcattcactggtctctgtttgttttcttcaatcaccccaaaggtcgcgataatattattgacctcttcctttatcagccacaatatcttaatgcaattcagacaatgtgtccacacattcttcgctatttgactacagcagtcataacaaacaaggatgttcgaaaacgtcggcaggttctaaaagatctagttaaagttattcaacaggagtcttacacatataaagacccaattacagaatttgttgaatgtttatatgttaactttgactttgatggggctcagaaaaagctgagggaatgtgaatcagtgcttgtgaatgacttcttcttggtggcttgtcttgaggatttcattgaaaatgcccgtctcttcatatttgagactttctgtcgcatccaccagtgtatcagcattaacatgttggcagataaattgaacatgactccagaagaagctgaaaggtggattgtaaatttgattagaaatgcaagactggatgccaagattgattctaaattaggtcatgtggttatgggtaacaatgcagtctcaccctatcagcaagtgattgaaaagaccaaaagcctttcctttagaagccagatgttggccatgaatattgagaagaaacttaatcagaatagcaggtcagaggctcctaactgggcaactcaagattctggcttctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: