Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SMCR7-Smith-Magenis syndrome chromosome region, candidate 7 Gene
PTXBC014973
New product
Data sheet of SMCR7-Smith-Magenis syndrome chromosome region, candidate 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMCR7-Smith-Magenis syndrome chromosome region, candidate 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014973 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMCR7 |
| Origin species: | Human |
| Product name: | SMCR7-Smith-Magenis syndrome chromosome region, candidate 7 Gene |
| Size: | 2ug |
| Accessions: | BC014973 |
| Gene id: | 125170 |
| Gene description: | Smith-Magenis syndrome chromosome region, candidate 7 |
| Synonyms: | SMCR7; MID49; mitochondrial dynamics protein MID49; Smith-Magenis syndrome chromosomal region candidate gene 7 protein; Smith-Magenis syndrome chromosome region, candidate 7; mitochondrial dynamic protein MID49; mitochondrial dynamic protein of 49 kDa; mitochondrial dynamics protein of 49 kDa; mitochondrial elongation factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagagttctcccagaaacgggggaagcggcgtagcgacgaagggctgggcagcatggtggacttcctcctggccaatgcccgcctggtgctgggcgtgggcggggctgctgtgctgggcattgccaccctggccgtgaagcggttcattgacagggccactagcccgcgggatgaggatgacaccaaggcagacagctggaaggaactgagcctgctcaaggccacaccacacctgcagccccggcctccacctgctgcccttagccagccagtgttgcccttggccccctcgtcgtctgccccagaagggcctgcagaaactgatcctgaggtgacaccacagctcagctccccagcaccgctgtgtctgacactgcaggagaggctgctggccttcgagcgggaccgtgtgaccatcccagcagcccaggtggctttggccaaacagctggctggcgacatcgccctggagctgcaggcctactttcggagcaagttcccggaactgccctttggggcattcgtgcctggggggccgctctacgacgggctgcaggcgggggctgcggaccatgtgcgtctcctggtgccactggtgctggagccgggcctgtggagcctggtgccgggcgtggacactgtggcgagggaccctcgctgctgggccgtgcgcaggacgcagcttgagttctgcccccgtgggagcagcccctgggaccgcttcctggtcgggggctacctctcctcccgcgtcctgctggagctactccgcaaggcgctggctgcctctgtcaactggccggccattggcagccttctcgggtgcctgatccggcccagcatggcctcggaggagctgctgctcgaggtgcagcacgaacgcctggagctcactgtggctgtgcttgtggcagtccctggggtcgatgctgacgaccgcctcctcttggcctggcccctggaggggctggcggggaacctctggctgcaggacctgtatccagtggaggctgctaggctgcgagccctggacgaccatgacgctgggactcgccggcggctgctgctgctgctgtgtgctgtctgccgtggttgctcggctctggggcagctaggccggggtcacctgacccaggtggtcctgcgtctgggggaggacaacgtggattggacggaggaggccttgggtgagcgcttcctgcaagccctggagctgctcatcggcagcctggagcaggccagcctgccctgccacttcaaccccagcgtgaacctcttcagcagcttgcgtgaggaggagattgacgacattggctatgcgctatacagtggcctacaggagcccgaggggctgctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ST6 beta-galactosamide alpha-2,6-sialyltranferase 2 - calcium/calmodulin-dependent protein kinase II delta - polymerase (DNA directed), gamma 2, accessory subunit - cytoplasmic polyadenylation element binding protein 1 |