EIF3I-eukaryotic translation initiation factor 3, subunit I Gene View larger

EIF3I-eukaryotic translation initiation factor 3, subunit I Gene

PTXBC000413

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF3I-eukaryotic translation initiation factor 3, subunit I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF3I-eukaryotic translation initiation factor 3, subunit I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000413
Product type: DNA & cDNA
Ncbi symbol: EIF3I
Origin species: Human
Product name: EIF3I-eukaryotic translation initiation factor 3, subunit I Gene
Size: 2ug
Accessions: BC000413
Gene id: 8668
Gene description: eukaryotic translation initiation factor 3, subunit I
Synonyms: EIF3S2; PRO2242; TRIP-1; TRIP1; eIF3-beta; eIF3-p36; eukaryotic translation initiation factor 3 subunit I; TGF-beta receptor-interacting protein 1; TGFbeta receptor-interacting protein 1; eukaryotic translation initiation factor 3 subunit 2; eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD); eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagccgatcctactgcagggccatgagcggtccattacgcagattaagtataaccgcgaaggagacctcctctttactgtggccaaggaccctatcgtcaatgtatggtactctgtgaatggtgagaggctgggcacctacatgggccataccggagctgtgtggtgtgtggacgctgactgggacaccaagcatgtcctcactggctcagctgacaacagctgtcgtctctgggactgtgaaacaggaaagcagctggcccttctcaagaccaattcggctgtccggacctgcggttttgactttgggggcaacatcatcatgttctccacggacaagcagatgggctaccagtgctttgtgagcttttttgacctgcgggatccgagccagattgacaacaatgagccctacatgaagatcccttgcaatgactctaaaatcaccagtgctgtttggggacccctgggggagtgcatcatcgctggccatgagagtggagagctcaaccagtatagtgccaagtctggagaggtgttggtgaatgttaaggagcactcccggcagatcaacgacatccagttatccagggacatgaccatgtttgtgaccgcgtccaaggacaacacagccaagctttttgactccacaactcttgaacatcagaagactttccggacagaacgtcctgtcaactcagctgccctctcccccaactatgaccatgtggtcctgggcggtggtcaggaagccatggatgtaaccacaacctccaccaggattggcaagtttgaggccaggttcttccatttggcctttgaagaagagtttggaagagtcaagggtcactttggacctatcaacagtgttgccttccatcctgatggcaagagctacagcagcggcggcgaagatggttacgtccgtatccattacttcgacccacagtacttcgaatttgagtttgaggcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TruB pseudouridine (psi) synthase homolog 2 (E. coli)
- transcriptional adaptor 1 (HFI1 homolog, yeast)-like
- wingless-type MMTV integration site family, member 7A
- actin related protein 2/3 complex, subunit 1B, 41kDa

Buy EIF3I-eukaryotic translation initiation factor 3, subunit I Gene now

Add to cart