Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene
PTXBC001172
New product
Data sheet of TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001172 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TADA2L |
| Origin species: | Human |
| Product name: | TADA2L-transcriptional adaptor 2 (ADA2 homolog, yeast)-like Gene |
| Size: | 2ug |
| Accessions: | BC001172 |
| Gene id: | 6871 |
| Gene description: | transcriptional adaptor 2 (ADA2 homolog, yeast)-like |
| Synonyms: | TADA2L; ADA2; ADA2A; KL04P; hADA2; transcriptional adapter 2-alpha; ADA2-like protein; transcriptional adaptor 2 alpha; transcriptional adaptor 2A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccgtttgggttcctttagcaatgatccctctgataagccaccttgccgaggctgctcctcctacctcatggagccttatatcaagtgtgctgaatgtgggccacctccttttttcctctgcttgcagtgtttcactcgaggctttgagtacaagaaacatcaaagcgatcatacttatgaaataatgacttcagattttcctgtccttgatcccagctggactgctcaagaagaaatggcccttttagaagctgtgatggactgtggctttggaaattggcaggatgtagccaatcaaatgtgcaccaagaccaaggaggagtgtgagaagcactatatgaagtatttcatcaataaccctctgtttgcatctaccctgctgaacctgaaacaagcagaggaagcaaaaactgctgacacagccattccatttcactctacagatgaccctccccgacctacctttgactccttgctttctcgggacatggccgggtacatgccagctcgagcagatttcattgaggaatttgacaattatgcagaatgggacttgagagacattgattttgttgaagatgactcggacattttacatgctctgaagatggctgtggtagatatctatcattccaggttaaaggagagacaaagacgaaaaaaaattataagagaccatggattaatcaaccttagaaagtttcaattaatggaacggcggtatcccaaggaggtccaggacctgtatgaaacaatgaggcgatttgcaagaattgtggggccagtggaacatgacaaattcattgaaagccatgcatgtaggtggtttttgagccttgagcagtatttgtgtgtgtatatttatataaataggagagataatggtgtgttttatgtgaagttctataaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 4 (formerly X), catalytic subunit - carnosine dipeptidase 1 (metallopeptidase M20 family) - eukaryotic translation initiation factor 3, subunit I - TruB pseudouridine (psi) synthase homolog 2 (E. coli) |