Login to display prices
Login to display prices
SPATA7-spermatogenesis associated 7 Gene View larger

SPATA7-spermatogenesis associated 7 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPATA7-spermatogenesis associated 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPATA7-spermatogenesis associated 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008656
Product type: DNA & cDNA
Ncbi symbol: SPATA7
Origin species: Human
Product name: SPATA7-spermatogenesis associated 7 Gene
Size: 2ug
Accessions: BC008656
Gene id: 55812
Gene description: spermatogenesis associated 7
Synonyms: HEL-S-296; HSD-3.1; HSD3; LCA3; spermatogenesis-associated protein 7; epididymis secretory protein Li 296; spermatogenesis-associated protein HSD3; spermatogenesis associated 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagattcagaaatgaacataaagcaggcatctaattgtgtgacatatgatgccaaagaaaaaatagctcctttacctttagaagggcatgactcaacatgggatgagattaaggatgatgctcttcagcattcctcaccaagggcaatgtgtcagtattccctgaagcccccttcaactcgtaaaatctactctgatgaagaagaactgttgtatctgagtttcattgaagatgtaacagatgaaattttgaaacttggtttattttcaaacaggtttttagaacgactgttcgagcgacatataaaacaaaataaacatttggaggaggaaaaaatgcgccacctgctgcatgtcctgaaagtagacttaggctgcacatcggaggaaaactcggtaaagcaaaatgatgttgatatgttgaatgtatttgattttgaaaaggctgggaattcagaaccaaatgaattaaaaaatgaaagtgaagtaacaattcagcaggaacgtcaacaataccaaaaggctttggatatgttattgtcggcaccaaaggatgagaacgagatattcccttcaccaactgaatttttcatgcctatttataaatcaaagcattcagaaggggttataattcaacaggtgaatgatgaaacaaatcttgaaacttcaactttggatgaaaatcatccaagtatttcagacagtttaacagatcgggaaacttctgtgaatgtcattgaaggtgatagtgaccctgaaaaggttgagatttcaaatggattatgtggtcttaacacatcaccctcccaatctgttcagttctccagtgtcaaaggcgacaataatcatgacatggagttatcaactcttaaaatcatggaaatgagcattgaggactgccctttggatgtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermatogenesis associated 4
- melanoma antigen family A, 2
- melanoma antigen family A, 4
- melanoma antigen family B, 2