Login to display prices
Login to display prices
MAGEA2-melanoma antigen family A, 2 Gene View larger

MAGEA2-melanoma antigen family A, 2 Gene

PTXBC013098

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEA2-melanoma antigen family A, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEA2-melanoma antigen family A, 2 Gene

Proteogenix catalog: PTXBC013098
Ncbi symbol: MAGEA2
Product name: MAGEA2-melanoma antigen family A, 2 Gene
Size: 2ug
Accessions: BC013098
Gene id: 4101
Gene description: melanoma antigen family A, 2
Synonyms: CT1.2; MAGE2; MAGEA2A; melanoma-associated antigen 2; MAGE-2 antigen; cancer/testis antigen 1.2; cancer/testis antigen family 1, member 2; melanoma antigen 2; melanoma antigen family A, 2; melanoma antigen family A2; MAGE family member A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcttgagcagaggagtcagcactgcaagcctgaagaaggccttgaggcccgaggagaggccctgggcctggtgggtgcgcaggctcctgctactgaggagcagcagaccgcttcttcctcttctactctagtggaagttaccctgggggaggtgcctgctgccgactcaccgagtcctccccacagtcctcagggagcctccagcttctcgactaccatcaactacactctttggagacaatccgatgagggctccagcaaccaagaagaggaggggccaagaatgtttcccgacctggagtccgagttccaagcagcaatcagtaggaagatggttgagttggttcattttctgctcctcaagtatcgagccagggagccggtcacaaaggcagaaatgctggagagtgtcctcagaaattgccaggacttctttcccgtgatcttcagcaaagcctccgagtacttgcagctggtctttggcattgaggtggtggaagtggtccccatcagccacttgtacatccttgtcacctgcctgggcctctcctacgatggcctgctgggcgacaatcaggtcatgcccaagacaggcctcctgataatcgtcctggccataatcgcaatagagggcgactgtgcccctgaggagaaaatctgggaggagctgagtatgttggaggtgtttgaggggagggaggacagtgtcttcgcacatcccaggaagctgctcacccaagatttggtgcaggaaaactacctggagtaccggcaggtgcccggcagtgatcctgcatgctacgagttcctgtggggtccaagggccctcattgaaaccagctatgtgaaagtcctgcaccatacactaaagatcggtggagaacctcacatttcctacccacccctgcatgaacgggctttgagagagggagaagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: