Cart 23 Product Products 2 820,44 € (empty)
-
1 x C12orf41-c...121,50 € -
1 x SPRY1-spro...121,50 € -
1 x PLXNB1-ple...113,40 € -
1 x SLC43A3-so...121,50 € -
1 x KCNJ15-pot...121,50 € -
1 x ZADH2-zinc...121,50 € -
-
1 x GEMIN7-gem...113,40 € -
1 x SPATA4-spe...121,50 € -
1 x TSPAN12-te...121,50 € -
1 x LIN28-lin-...113,40 € -
1 x LENG1-leuk...113,40 € -
-
1 x SSU72-SSU7...113,40 € -
1 x ZNF276-zin...121,50 € -
1 x C11orf64-c...113,40 € -
1 x YIPF2-Yip1...121,50 € -
1 x CXCL3-chem...113,40 € -
1 x C1D-nuclea...113,40 € -
1 x CD34-CD34...121,50 € -
-
-
1 x SATL1-sper...121,50 €
No products
To be determined Shipping
2 820,44 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 820,44 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 820,44 €
Data sheet of MAGEA4-melanoma antigen family A, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEA4-melanoma antigen family A, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017723 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEA4 |
| Origin species: | Human |
| Product name: | MAGEA4-melanoma antigen family A, 4 Gene |
| Size: | 2ug |
| Accessions: | BC017723 |
| Gene id: | 4103 |
| Gene description: | melanoma antigen family A, 4 |
| Synonyms: | CT1.4; MAGE-41; MAGE-X2; MAGE4; MAGE4A; MAGE4B; melanoma-associated antigen 4; MAGE-4 antigen; MAGE-41 antigen; MAGE-X2 antigen; cancer/testis antigen 1.4; cancer/testis antigen family 1, member 4; melanoma antigen family A, 4; melanoma antigen family A4; MAGE family member A4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttctgagcagaagagtcagcactgcaagcctgaggaaggcgttgaggcccaagaagaggccctgggcctggtgggtgcacaggctcctactactgaggagcaggaggctgctgtctcctcctcctctcctctggtccctggcaccctggaggaagtgcctgctgctgagtcagcaggtcctccccagagtcctcagggagcctctgccttacccactaccatcagcttcacttgctggaggcaacccaatgagggttccagcagccaagaagaggaggggccaagcacctcgcctgacgcagagtccttgttccgagaagcactcagtaacaaggtggatgagttggctcattttctgctccgcaagtatcgagccaaggagctggtcacaaaggcagaaatgctggagagagtcatcaaaaattacaagcgctgctttcctgtgatcttcggcaaagcctccgagtccctgaagatgatctttggcattgacgtgaaggaagtggaccccaccagcaacacctacacccttgtcacctgcctgggcctttcctatgatggcctgctgggtaataatcagatctttcccaagacaggccttctgataatcgtcctgggcacaattgcaatggagggcgacagcgcctctgaggaggaaatctgggaggagctgggtgtgatgggggtgtatgatgggagggagcacactgtctatggggagcccaggaaactgctcacccaagattgggtgcaggaaaactacctggagtaccggcaggtacccggcagtaatcctgcgcgctatgagttcctgtggggtccaagggctctggctgaaaccagctatgtgaaagtcctggagcatgtggtcagggtcaatgcaagagttcgcattgcctacccatccctgcgtgaagcagctttgttagaggaggaagagggagtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - melanoma antigen family B, 2 - transmembrane protein 120A - SEC13 homolog (S. cerevisiae) - tRNA isopentenyltransferase 1 |