Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MAGEB2-melanoma antigen family B, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAGEB2-melanoma antigen family B, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026071 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAGEB2 |
| Origin species: | Human |
| Product name: | MAGEB2-melanoma antigen family B, 2 Gene |
| Size: | 2ug |
| Accessions: | BC026071 |
| Gene id: | 4113 |
| Gene description: | melanoma antigen family B, 2 |
| Synonyms: | CT3.2; DAM6; MAGE-XP-2; melanoma-associated antigen B2; DSS/AHC critical interval MAGE superfamily 6; MAGE XP-2 antigen; MAGE-B2 antigen; cancer/testis antigen 3.2; cancer/testis antigen family 3, member 2; melanoma antigen family B, 2; melanoma antigen family B2; MAGE family member B2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcgtggtcagaagagtaagctccgtgcccgtgagaaacgccgcaaggcccgagatgagacccggggtctcaatgttcctcaggtcactgaagcagaggaagaagaggccccctgctgttcctcttctgtttctgggggtgctgcttcaagctctcctgctgctggcattccccagaagcctcagagagccccaaccactgccgctgctgcagctgcgggtgtttcatccacaaaatctaaaaaaggtgccaagagccaccaaggtgagaaaaatgcaagttcctcccaggcctcaacatctactaagagcccaagcgaagatcctctaaccaggaagtcagggtcgttggtgcagttcctgttgtacaagtataaaataaaaaagtccgttacaaagggagaaatgctgaaaattgttggcaaaaggttcagggagcacttccctgagatcctcaagaaagcctctgagggcctcagtgttgtctttggccttgagctgaataaagtcaaccccaacggccacacttacaccttcatcgacaaggtagacctcactgatgaggaatccctgctcagttcctgggactttcccaggagaaagcttctgatgcctctcctgggtgtgatcttcttaaatggcaactcagctactgaggaagagatctgggaattcctgaatatgttgggagtctatgatggagaggagcactcagtctttggggaaccctggaagctcatcaccaaagatctggtgcaggaaaaatatctggagtacaagcaggtgcccagcagtgatcccccacgctttcaattcctgtggggtccgagagcctatgctgaaaccagcaagatgaaagtcctggagtttttggccaaggtaaatggtaccaccccctgtgccttcccaacccattacgaagaagctttgaaagatgaagagaaagccggagtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 120A - SEC13 homolog (S. cerevisiae) - tRNA isopentenyltransferase 1 - G protein pathway suppressor 2 |