GPS2-G protein pathway suppressor 2 Gene View larger

GPS2-G protein pathway suppressor 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPS2-G protein pathway suppressor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPS2-G protein pathway suppressor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013652
Product type: DNA & cDNA
Ncbi symbol: GPS2
Origin species: Human
Product name: GPS2-G protein pathway suppressor 2 Gene
Size: 2ug
Accessions: BC013652
Gene id: 2874
Gene description: G protein pathway suppressor 2
Synonyms: AMF-1; G protein pathway suppressor 2; GPS-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgcactcctggagcgccccaagctttccaacgccatggccagggcgctgcaccggcacattatgatggagcgggagcgcaagcggcaggaggaagaagaggtggataagatgatggaacagaagatgaaggaagaacaggagagaaggaagaaaaaggagatggaagagagaatgtcattagaggagaccaaggaacaaattctgaagttggaggagaagcttttggctctacaggaagagaagcaccagcttttcctgcagctcaagaaagttttacatgaggaagaaaaacggaggcgaaaggaacagagtgacctgaccaccctaacatcagctgcataccagcagagcctgactgttcacacaggaactcatctcctcagcatgcaggggagccctggaggacacaatcgcccaggcaccctcatggcagctgacagagccaaacaaatgtttggaccccaagtgcttacgacccggcactacgtgggctcagcagctgcttttgcagggacaccagagcatggacaattccaaggcagtcctggtggtgcctatgggactgctcagcccccacctcactatgggcccacacagccagcttatagtcctagtcagcagctcagagctccttcggcattccctgcagtgcagtacctatctcagccacagccacagccctatgctgtgcatggccactttcagcccactcagacaggtttcctccagcctggtggtgccctgtccttgcaaaagcagatggaacatgctaaccagcagactggcttctccgactcatcctctctgcgccccatgcacccccaggctctgcatccagcccctggactccttgcttccccccagctccctgtgcagatgcagccagcaggaaagtcgggctttgcagctaccagccaacctggccctcggctccccttcatccaacacagccagaacccgcgattctaccacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - musashi homolog 2 (Drosophila)
- G protein-coupled receptor 18
- RAD51 associated protein 1
- transcription factor 19 (SC1)

Buy GPS2-G protein pathway suppressor 2 Gene now

Add to cart