GPR18-G protein-coupled receptor 18 Gene View larger

GPR18-G protein-coupled receptor 18 Gene

PTXBC008569

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR18-G protein-coupled receptor 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR18-G protein-coupled receptor 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008569
Product type: DNA & cDNA
Ncbi symbol: GPR18
Origin species: Human
Product name: GPR18-G protein-coupled receptor 18 Gene
Size: 2ug
Accessions: BC008569
Gene id: 2841
Gene description: G protein-coupled receptor 18
Synonyms: N-arachidonyl glycine receptor; NAGly receptor; G protein-coupled receptor 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcaccctgaacaatcaagatcaacctgtcccttttaacagctcacatccagatgaatacaaaattgcagcccttgtcttctatagctgtatcttcataattggattatttgttaacatcactgcattatgggttttcagttgtaccaccaagaagagaaccacggtaaccatctatatgatgaatgtggcattagtggacttgatatttataatgactttaccctttcgaatgttttattatgcaaaagatgaatggccatttggagagtacttctgccagattcttggagctctcacagtgttttacccaagcattgctttatggcttcttgcctttattagtgctgacagatacatggccattgtacagccgaagtacgccaaagaacttaaaaacacgtgcaaagccgtgctggcgtgtgtgggagtctggataatgaccctgaccacgaccacccctctgctactgctctataaagacccagataaagactccactcccgccacctgcctcaagatttctgacatcatctatctaaaagctgtgaacgtgctgaacctcactcgactgacattttttttcttgattcctttgttcatcatgattgggtgctacttggtcattattcataatctccttcacggcaggacgtctaagctgaaacccaaagtcaaggagaagtccataaggatcatcatcacgctgctggtgcaggtgctcgtctgctttatgcccttccacatctgtttcgctttcctgatgctgggaacgggggagaacagttacaatccctggggagcctttaccaccttcctcatgaacctcagcacgtgtctggatgtgattctctactacatcgtttcaaaacaatttcaggctcgagtcattagtgtcatgctataccgtaattaccttcgaagcatgcgcagaaaaagtttccgatctggtagtctacggtcactaagcaatataaacagtgaaatgttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAD51 associated protein 1
- transcription factor 19 (SC1)
- dead end homolog 1 (zebrafish)
- G protein-coupled receptor 85

Buy GPR18-G protein-coupled receptor 18 Gene now

Add to cart