Login to display prices
Login to display prices
GPR18-G protein-coupled receptor 18 Gene View larger

GPR18-G protein-coupled receptor 18 Gene

PTXBC008569

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR18-G protein-coupled receptor 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR18-G protein-coupled receptor 18 Gene

Proteogenix catalog: PTXBC008569
Ncbi symbol: GPR18
Product name: GPR18-G protein-coupled receptor 18 Gene
Size: 2ug
Accessions: BC008569
Gene id: 2841
Gene description: G protein-coupled receptor 18
Synonyms: N-arachidonyl glycine receptor; NAGly receptor; G protein-coupled receptor 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcaccctgaacaatcaagatcaacctgtcccttttaacagctcacatccagatgaatacaaaattgcagcccttgtcttctatagctgtatcttcataattggattatttgttaacatcactgcattatgggttttcagttgtaccaccaagaagagaaccacggtaaccatctatatgatgaatgtggcattagtggacttgatatttataatgactttaccctttcgaatgttttattatgcaaaagatgaatggccatttggagagtacttctgccagattcttggagctctcacagtgttttacccaagcattgctttatggcttcttgcctttattagtgctgacagatacatggccattgtacagccgaagtacgccaaagaacttaaaaacacgtgcaaagccgtgctggcgtgtgtgggagtctggataatgaccctgaccacgaccacccctctgctactgctctataaagacccagataaagactccactcccgccacctgcctcaagatttctgacatcatctatctaaaagctgtgaacgtgctgaacctcactcgactgacattttttttcttgattcctttgttcatcatgattgggtgctacttggtcattattcataatctccttcacggcaggacgtctaagctgaaacccaaagtcaaggagaagtccataaggatcatcatcacgctgctggtgcaggtgctcgtctgctttatgcccttccacatctgtttcgctttcctgatgctgggaacgggggagaacagttacaatccctggggagcctttaccaccttcctcatgaacctcagcacgtgtctggatgtgattctctactacatcgtttcaaaacaatttcaggctcgagtcattagtgtcatgctataccgtaattaccttcgaagcatgcgcagaaaaagtttccgatctggtagtctacggtcactaagcaatataaacagtgaaatgttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: