GPR85-G protein-coupled receptor 85 Gene View larger

GPR85-G protein-coupled receptor 85 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR85-G protein-coupled receptor 85 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPR85-G protein-coupled receptor 85 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030577
Product type: DNA & cDNA
Ncbi symbol: GPR85
Origin species: Human
Product name: GPR85-G protein-coupled receptor 85 Gene
Size: 2ug
Accessions: BC030577
Gene id: 54329
Gene description: G protein-coupled receptor 85
Synonyms: SREB; SREB2; seven transmembrane helix receptor; super conserved receptor expressed in brain 2; G protein-coupled receptor 85
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaactatagccatgcagctgacaacattttgcaaaatctctcgcctctaacagcctttctgaaactgacttccttgggtttcataataggagtcagcgtggtgggcaacctcctgatctccattttgctagtgaaagataagaccttgcatagagcaccttactacttcctgttggatctttgctgttcagatatcctcagatctgcaatttgtttcccatttgtgttcaactctgtcaaaaatggctctacctggacttatgggactctgacttgcaaagtgattgcctttctgggggttttgtcctgtttccacactgctttcatgctcttctgcatcagtgtcaccagatacttagctatcgcccatcaccgcttctatacaaagaggctgaccttttggacgtgtctggctgtgatctgtatggtgtggactctgtctgtggccatggcatttcccccggttttagacgtgggcacttactcattcattagggaggaagatcaatgcgccttccaacaccgctccttcagggctaatgattccttaggatttatgctgcttcttgctctcatcctcctagccacacagcttgtctacctcaagctgatatttttcgtccacgatcgaagaaaaatgaagccagtccagtttgtagcagcagtcagccagaactggacttttcatggtcctggagccagtggccaggcagctgccaattggctagcaggatttggaaggggtcccacaccacccaccttgctgggcatcaggcaaaatgcaaacaccacaggcagaagaaggctattggtcttagacgagttcaaaatggagaaaagaatcagcagaatgttctatataatgacttttctgtttctaaccttgtggggcccctacctggtggcctgttattggagagtttttgcaagagggcctgtagtaccagggggatttctaacagctgctgtctggatgagttttgcccaagcaggaatcaatccttttgtctgcattttctcaaacagggagctgaggcgctgtttcagcacaacccttctttactgcagaaaatccaggttaccaagggaaccttactgtgttatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family C, 2
- ArfGAP with dual PH domains 1
- ArfGAP with dual PH domains 2
- selenophosphate synthetase 1

Buy GPR85-G protein-coupled receptor 85 Gene now

Add to cart