Cart 44 Product Products 14 641,09 € (empty)
-
-
-
-
-
-
-
-
-
-
-
-
-
1 x MAGE-9...259,07 € -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
1 x MDH1-malat...121,50 € -
1 x KNCN-kinoc...113,40 € -
-
-
-
-
-
-
-
-
-
-
-
No products
To be determined Shipping
14 641,09 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 44 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 14 641,09 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 14 641,09 €
Data sheet of GPR85-G protein-coupled receptor 85 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR85-G protein-coupled receptor 85 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030577 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR85 |
| Origin species: | Human |
| Product name: | GPR85-G protein-coupled receptor 85 Gene |
| Size: | 2ug |
| Accessions: | BC030577 |
| Gene id: | 54329 |
| Gene description: | G protein-coupled receptor 85 |
| Synonyms: | SREB; SREB2; seven transmembrane helix receptor; super conserved receptor expressed in brain 2; G protein-coupled receptor 85 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaactatagccatgcagctgacaacattttgcaaaatctctcgcctctaacagcctttctgaaactgacttccttgggtttcataataggagtcagcgtggtgggcaacctcctgatctccattttgctagtgaaagataagaccttgcatagagcaccttactacttcctgttggatctttgctgttcagatatcctcagatctgcaatttgtttcccatttgtgttcaactctgtcaaaaatggctctacctggacttatgggactctgacttgcaaagtgattgcctttctgggggttttgtcctgtttccacactgctttcatgctcttctgcatcagtgtcaccagatacttagctatcgcccatcaccgcttctatacaaagaggctgaccttttggacgtgtctggctgtgatctgtatggtgtggactctgtctgtggccatggcatttcccccggttttagacgtgggcacttactcattcattagggaggaagatcaatgcgccttccaacaccgctccttcagggctaatgattccttaggatttatgctgcttcttgctctcatcctcctagccacacagcttgtctacctcaagctgatatttttcgtccacgatcgaagaaaaatgaagccagtccagtttgtagcagcagtcagccagaactggacttttcatggtcctggagccagtggccaggcagctgccaattggctagcaggatttggaaggggtcccacaccacccaccttgctgggcatcaggcaaaatgcaaacaccacaggcagaagaaggctattggtcttagacgagttcaaaatggagaaaagaatcagcagaatgttctatataatgacttttctgtttctaaccttgtggggcccctacctggtggcctgttattggagagtttttgcaagagggcctgtagtaccagggggatttctaacagctgctgtctggatgagttttgcccaagcaggaatcaatccttttgtctgcattttctcaaacagggagctgaggcgctgtttcagcacaacccttctttactgcagaaaatccaggttaccaagggaaccttactgtgttatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - melanoma antigen family C, 2 - ArfGAP with dual PH domains 1 - ArfGAP with dual PH domains 2 - selenophosphate synthetase 1 |