Login to display prices
Login to display prices
SEPHS1-selenophosphate synthetase 1 Gene View larger

SEPHS1-selenophosphate synthetase 1 Gene

PTXBC000941

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEPHS1-selenophosphate synthetase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SEPHS1-selenophosphate synthetase 1 Gene

Proteogenix catalog: PTXBC000941
Ncbi symbol: SEPHS1
Product name: SEPHS1-selenophosphate synthetase 1 Gene
Size: 2ug
Accessions: BC000941
Gene id: 22929
Gene description: selenophosphate synthetase 1
Synonyms: SELD; SPS; SPS1; selenide, water dikinase 1; selenium donor protein 1; selenophosphate synthase 1; selenophosphate synthetase 1 +E9; selenophosphate synthetase 1 +E9a; selenophosphate synthetase 1 delta E2; selenophosphate synthetase 1 delta E8; selenophosphate synthetase 1 major; selenophosphate synthetase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctacgcgggagtcctttaacccggaaagttacgaattggacaaaagcttccggctaaccagattcactgaactgaagggcacaggctgcaaagtgccccaagatgtcctgcaaaaattgctggaatctttacaggagaaccacttccaagaagatgagcagtttctgggagccgttatgccaaggcttggcattggaatggatacttgtgtcattcctttgaggcacggtgggctttccttggttcaaaccacagattacatttacccgatcgtagacgacccttacatgatgggcaggatagcgtgtgccaatgtcctcagtgacctctatgcaatgggggtcacggaatgtgacaatatgctgatgctccttggagtcagtaataaaatgaccgacagggaaagggataaagtgatgcctctgattatccaaggttttaaagacgcagctgaggaagcaggaacatctgtaacaggcggccaaacagtactaaacccctggattgtcctgggaggagtggctaccactgtctgccaacccaatgaatttatcatgccagacaatgcagtgccaggggacgtgctggtgctgacaaaacccctggggacacaggtggcagtggctgtgcaccagtggctggatatccctgagaaatggaataagattaaactagtggtcacccaagaagatgtagagctggcctaccaggaggcgatgatgaacatggcgaggctcaacaggacagctgcaggactcatgcacacgttcaatgcccacgccgccactgacatcacgggcttcgggattttgggccatgcgcagaacctggccaagcagcagaggaacgaggtgtcgtttgtaattcacaacctcccggtgctggccaagatggctgcggtgagcaaggcctgcggaaacatgttcggcctcatgcacgggacctgcccggagacttcaggcggccttctgatctgtttaccacgtgagcaagcagctcggttctgtgcagagataaagtcccccaaatatggtgaaggccaccaagcatggattattgggattgtagagaagggcaaccgcacagccagaatcatagacaaaccccggatcatcgaggtcgcaccacaagtggccactcaaaatgtgaatcccacacccggggccacctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: