Login to display prices
Login to display prices
SPZ1-spermatogenic leucine zipper 1 Gene View larger

SPZ1-spermatogenic leucine zipper 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPZ1-spermatogenic leucine zipper 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPZ1-spermatogenic leucine zipper 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033798
Product type: DNA & cDNA
Ncbi symbol: SPZ1
Origin species: Human
Product name: SPZ1-spermatogenic leucine zipper 1 Gene
Size: 2ug
Accessions: BC033798
Gene id: 84654
Gene description: spermatogenic leucine zipper 1
Synonyms: NYD-TSP1; PPP1R148; spermatogenic leucine zipper protein 1; protein phosphatase 1, regulatory subunit 148; spermatogenic zip 1; testis secretory sperm-binding protein Li 232m; testis-specific protein 1; spermatogenic leucine zipper 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagctctgctaagtcagctgagatgcccaccatctccaaaacccttaaccctactcctgatcctcatcaagaatatctggaccctaggattaccattgccttattcgaaattggatcacattccccttcctcctggggctctctccctttcctaaagaatagcagccatcaagttacagaacaacagactgcacagaagtttaacaatctcttaaaagaaattaaagatattcttaaaaatatggcaggttttgaagagaagatcacagaagcaaaagaactttttgaggaaaccaatattactgaggatgtgtcagcccacaaagaaaatatcagaggacttgacaaaatcaatgaaatgttatcaacaaacctgcctgttagtttagccccagagaaagaagacaatgaaaagaaacaggagatgatattggaaaccaatattactgaggatgtgtcagcccacaaagaaaatatcagaggacttgacaaaatcaatgaaatgttatcaacaaacctgcctgttagtttagccccagagaaagaagacaatgaaaagaaacagcagatgataatggaaaaccagaactctgagaacaccgcacaagtttttgcaagagatttggtaaatcgtttagaagaaaaaaaagtccttaacgaaactcaacaaagtcaggaaaaagcaaaaaacagacttaatgttcaagaagaaactatgaaaattaggaacaacatggagcagttactacaggaagcagaacactggagtaaacaacatactgagctcagtaaactgataaaatcctatcagaaatctcagaaagacataagtgaaactcttggaaataatggagtcggtttccaaacccagccaaataatgaagtgtcggctaagcatgagctggaggaacaggtgaagaaactgagccatgacacctattcattgcagttgatggcagctttgctagagaatgaatgccaaatcttacagcagagagtagagattctcaaggaactccatcatcagaaacagggaactctgcaagagaagccaattcagataaactataaacaggacaagaaaaatcagaagccatcagaagcaaagaaagtagaaatgtataagcagaacaagcaagcaatgaagggtacattttggaaaaaagacagatcctgtagaagcctggatgtttgtcttaataagaaagcttgcaatacccagttcaatattcatgttgcaagaaaagctcttaggggaaaaatgaggtcagctagcagcctaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - arrestin domain containing 1
- interferon regulatory factor 3
- interferon regulatory factor 6
- peter pan homolog (Drosophila)