Login to display prices
Login to display prices
SPATA4-spermatogenesis associated 4 Gene View larger

SPATA4-spermatogenesis associated 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPATA4-spermatogenesis associated 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPATA4-spermatogenesis associated 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021731
Product type: DNA & cDNA
Ncbi symbol: SPATA4
Origin species: Human
Product name: SPATA4-spermatogenesis associated 4 Gene
Size: 2ug
Accessions: BC021731
Gene id: 132851
Gene description: spermatogenesis associated 4
Synonyms: SPEF1B; spermatogenesis-associated protein 4; testis and spermatogenesis cell related protein 2; testis spermatocyte apoptosis-related gene 2 protein; spermatogenesis associated 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccgccggccaggaaaaagggtatttgacacagactgcggcagccctagacaagtcaccgtcactttcgccacagctagcagctcccatccgagggaggcctaagaagtgtctggtctatccgcatgcgccgaagagctcccgcttgtctcgttccgttctgcgttggcttcagggtctggatctcagcttcttccccagggacatcaacagagatttttcaaatggcttcctaattgcagaaatattctgtatatattacccctgggaacttgaattatcatcctttgaaaacgggacctctttaaaagtcaagttggataactgggcacagttggagaagttcctggcaagaaaaaaatttaaattacctaaagaactaatccatggaacaattcattgtaaagctggagtgcctgaaatattgatagaagaggtttacactttattaacacatcgagaaattaaaagtatccaggatgactttgtgaatttcacggactatagctaccagatgcgtttacccctggtttccaggtctacagtttcgaagtctattaaagataacattaggttatcagaattactaagcaatcccaacatgctgaccaatgaacttaaagcagagttcctcatccttttacatatgttgcaaagaaaattaggcagaaaattgaatccagaatggtttgatgtgaaaccaacagtgggagaagttactctcaatcaccttcctgcccaagcctctgggcgcagatataatttaaaagttaaaagaggaagagttgtccctgttttaccaaatataggtagtggtggcagttcacatagagaaatacatgtgaagcaagctggacaacattcttattactctgctatgaaacctatcagaaacatggacaagaaaccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 2
- melanoma antigen family A, 4
- melanoma antigen family B, 2
- transmembrane protein 120A