SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene View larger

SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene

PTXBC004974

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004974
Product type: DNA & cDNA
Ncbi symbol: SPARC
Origin species: Human
Product name: SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene
Size: 2ug
Accessions: BC004974
Gene id: 6678
Gene description: secreted protein, acidic, cysteine-rich (osteonectin)
Synonyms: BM-40; OI17; basement-membrane protein 40; secreted protein, acidic, cysteine-rich (osteonectin); secreted protein acidic and cysteine rich
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcctggatcttctttctcctttgcctggccgggagggccttggcagcccctcagcaagaagccctgcctgatgagacagaggtggtggaagaaactgtggcagaggtgactgaggtatctgtgggagctaatcctgtccaggtggaagtaggagaatttgatgatggtgcagaggaaaccgaagaggaggtggtggcggaaaatccctgccagaaccaccactgcaaacacggcaaggtgtgcgagctggatgagaacaacacccccatgtgcgtgtgccaggaccccaccagctgcccagcccccattggcgagtttgagaaggtgtgcagcaatgacaacaagaccttcgactcttcctgccacttctttgccacaaagtgcaccctggagggcaccaagaagggccacaagctccacctggactacatcgggccttgcaaatacatccccccttgcctggactctgagctgaccgaattccccctgcgcatgcgggactggctcaagaacgtcctggtcaccctgtatgagagggatgaggacaacaaccttctgactgagaagcagaagctgcgggtgaagaagatccatgagaatgagaagcgcctggaggcaggagaccaccccgtggagctgctggcccgggacttcgagaagaactataacatgtacatcttccctgtacactggcagttcggccagctggaccagcaccccattgacgggtacctctcccacaccgagctggctccactgcgtgctcccctcatccccatggagcattgcaccacccgctttttcgagacctgtgacctggacaatgacaagtacatcgccctggatgagtgggccggctgcttcggcatcaagcagaaggatatcgacaaggatcttgtgatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcriptional adaptor 2 (ADA2 homolog, yeast)-like
- protein phosphatase 4 (formerly X), catalytic subunit
- carnosine dipeptidase 1 (metallopeptidase M20 family)
- eukaryotic translation initiation factor 3, subunit I

Buy SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene now

Add to cart