Cart 3 Product Products 364,50 € (empty)
-
1 x PLCZ1-phos...121,50 € -
1 x ZFP161-zin...121,50 € -
1 x C20orf185-...121,50 €
No products
To be determined Shipping
364,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 364,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 364,50 €
View larger 
SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene
PTXBC004974
New product
Data sheet of SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004974 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPARC |
| Origin species: | Human |
| Product name: | SPARC-secreted protein, acidic, cysteine-rich (osteonectin) Gene |
| Size: | 2ug |
| Accessions: | BC004974 |
| Gene id: | 6678 |
| Gene description: | secreted protein, acidic, cysteine-rich (osteonectin) |
| Synonyms: | BM-40; OI17; basement-membrane protein 40; secreted protein, acidic, cysteine-rich (osteonectin); secreted protein acidic and cysteine rich |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggcctggatcttctttctcctttgcctggccgggagggccttggcagcccctcagcaagaagccctgcctgatgagacagaggtggtggaagaaactgtggcagaggtgactgaggtatctgtgggagctaatcctgtccaggtggaagtaggagaatttgatgatggtgcagaggaaaccgaagaggaggtggtggcggaaaatccctgccagaaccaccactgcaaacacggcaaggtgtgcgagctggatgagaacaacacccccatgtgcgtgtgccaggaccccaccagctgcccagcccccattggcgagtttgagaaggtgtgcagcaatgacaacaagaccttcgactcttcctgccacttctttgccacaaagtgcaccctggagggcaccaagaagggccacaagctccacctggactacatcgggccttgcaaatacatccccccttgcctggactctgagctgaccgaattccccctgcgcatgcgggactggctcaagaacgtcctggtcaccctgtatgagagggatgaggacaacaaccttctgactgagaagcagaagctgcgggtgaagaagatccatgagaatgagaagcgcctggaggcaggagaccaccccgtggagctgctggcccgggacttcgagaagaactataacatgtacatcttccctgtacactggcagttcggccagctggaccagcaccccattgacgggtacctctcccacaccgagctggctccactgcgtgctcccctcatccccatggagcattgcaccacccgctttttcgagacctgtgacctggacaatgacaagtacatcgccctggatgagtgggccggctgcttcggcatcaagcagaaggatatcgacaaggatcttgtgatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcriptional adaptor 2 (ADA2 homolog, yeast)-like - protein phosphatase 4 (formerly X), catalytic subunit - carnosine dipeptidase 1 (metallopeptidase M20 family) - eukaryotic translation initiation factor 3, subunit I |