C10orf46-chromosome 10 open reading frame 46 Gene View larger

C10orf46-chromosome 10 open reading frame 46 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C10orf46-chromosome 10 open reading frame 46 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C10orf46-chromosome 10 open reading frame 46 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038294
Product type: DNA & cDNA
Ncbi symbol: C10orf46
Origin species: Human
Product name: C10orf46-chromosome 10 open reading frame 46 Gene
Size: 2ug
Accessions: BC038294
Gene id: 143384
Gene description: chromosome 10 open reading frame 46
Synonyms: C10orf46; CAC1; CDK2-associated and cullin domain-containing protein 1; Cdk-Associated Cullin1; cullin; CDK2 associated cullin domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggaaagcatggaagaggaggaggggggcagctacgaggcgatgatggacgaccagaaccacaacaactgggaggctgcggtggacggcttccggcagcccctgccacctccgccgcccccctcgtcgatcccggcccctgcccgagagcctccgggggggcagctgctggcggtgcccgcggtctccgtggacaggaaaggccccaaggaggggctcccgatggggccgcagccaccgccggaggctaatggggtgatcatgatgttgaagagctgcgacgcggccgccgccgtggccaaggcggcccccgcccccaccgccagctccaccatcaacatcaacacctccacctccaagttcttaatgaatgttataactattgaagattataagagcacatactggccaaaattggatggtgccatagatcaacttttaactcagagtcctggtgactatatccccatatcctatgaacagatatacagttgtgtgtataaatgtgtatgccagcagcactcggaacagatgtatagtgatctgattaaaaagataactaatcacttagagagagtctcaaaggagctgcaggccagccctccagatctctatattgaaagatttaatatagctcttggacaatatatgggagcattgcagagcattgtgcctcttttcatatatatgaataagttttacatcgaaaccaagcttaacagagacttaaaagatgaccttataaagctgtttacggaacatgttgcagaaaagcacatttacagcctaatgcctttacttttagaagcccagtcaacaccatttcaggtcacaccttcaactatggcaaatattgtgaaaggcctgtataccctcagaccagtttctcagaattttacagcagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 22 open reading frame 29
- solute carrier family 25, member 38
- chromosome 10 open reading frame 54
- chromosome 11 open reading frame 65

Buy C10orf46-chromosome 10 open reading frame 46 Gene now

Add to cart