Login to display prices
Login to display prices
C11orf65-chromosome 11 open reading frame 65 Gene View larger

C11orf65-chromosome 11 open reading frame 65 Gene

PTXBC029536

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf65-chromosome 11 open reading frame 65 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf65-chromosome 11 open reading frame 65 Gene

Proteogenix catalog: PTXBC029536
Ncbi symbol: C11orf65
Product name: C11orf65-chromosome 11 open reading frame 65 Gene
Size: 2ug
Accessions: BC029536
Gene id: 160140
Gene description: chromosome 11 open reading frame 65
Synonyms: uncharacterized protein C11orf65; chromosome 11 open reading frame 65
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttggaaagaggaatcagaatttacaaagcaggataaggctgccagagtcattcagcaggcctggaaaagtttccttaatgtcgctatatttcaacactttaaaagtctgattgatttaagaagacaaggagaaccacgtcagatagtgaaatatattaatcccaaagaggcagagcttctagatgctgctgctggcattcatgtgcgattcagattaggtggagttaaatttccacctgatatatactataagatttttactcacagacctattgaagatctctgtgctaacagccctagaaattatgcaaaacttccagcaaagcatacatctcataataaaaatgatcatcttcaggaagaggatcatagtggctggtatcatcgtatagaaaacaatggctggaggccagtttctgatacattttggctatctactgatggtatggtggtggaagacaaaaaggaaagtgaattccatttctctaaactgaagagaaggcaagatttggaaaagaaaagaaaacttagaaaaatagagtggatgaggcaaatgtactactcaggaagtctggaggctaagtcaacacatcatgaaactctaggactaattcacactgcaacaaaggggctgattagagcttttgaagatggggggatagattctgtgatggaatgggaagtggatgaagtgctgaactggacaaatacactgaactttgatgagtacattgccagctggaaggaaattgctacaagcaactcttcggctaacttcaaaggattcaggtttaatcaagcacagaaaaacatatataactatggaggagacatatcaaagatgcaaatgggaataccagatgatacttactatgaaaatgtttatcaagaaccaaatgtaactagattaacgcctgattctacttatggactataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: