C11orf65-chromosome 11 open reading frame 65 Gene View larger

C11orf65-chromosome 11 open reading frame 65 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf65-chromosome 11 open reading frame 65 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf65-chromosome 11 open reading frame 65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029536
Product type: DNA & cDNA
Ncbi symbol: C11orf65
Origin species: Human
Product name: C11orf65-chromosome 11 open reading frame 65 Gene
Size: 2ug
Accessions: BC029536
Gene id: 160140
Gene description: chromosome 11 open reading frame 65
Synonyms: uncharacterized protein C11orf65; chromosome 11 open reading frame 65
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttggaaagaggaatcagaatttacaaagcaggataaggctgccagagtcattcagcaggcctggaaaagtttccttaatgtcgctatatttcaacactttaaaagtctgattgatttaagaagacaaggagaaccacgtcagatagtgaaatatattaatcccaaagaggcagagcttctagatgctgctgctggcattcatgtgcgattcagattaggtggagttaaatttccacctgatatatactataagatttttactcacagacctattgaagatctctgtgctaacagccctagaaattatgcaaaacttccagcaaagcatacatctcataataaaaatgatcatcttcaggaagaggatcatagtggctggtatcatcgtatagaaaacaatggctggaggccagtttctgatacattttggctatctactgatggtatggtggtggaagacaaaaaggaaagtgaattccatttctctaaactgaagagaaggcaagatttggaaaagaaaagaaaacttagaaaaatagagtggatgaggcaaatgtactactcaggaagtctggaggctaagtcaacacatcatgaaactctaggactaattcacactgcaacaaaggggctgattagagcttttgaagatggggggatagattctgtgatggaatgggaagtggatgaagtgctgaactggacaaatacactgaactttgatgagtacattgccagctggaaggaaattgctacaagcaactcttcggctaacttcaaaggattcaggtttaatcaagcacagaaaaacatatataactatggaggagacatatcaaagatgcaaatgggaataccagatgatacttactatgaaaatgtttatcaagaaccaaatgtaactagattaacgcctgattctacttatggactataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inositol 1,3,4-triphosphate 5/6 kinase
- cysteine-rich with EGF-like domains 2
- chromosome 19 open reading frame 62
- chromosome 11 open reading frame 42

Buy C11orf65-chromosome 11 open reading frame 65 Gene now

Add to cart